1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleonysh [2.5K]
2 years ago
7

Should glucose erythrocytes leukocytes and protein appear in the urine

Biology
1 answer:
saveliy_v [14]2 years ago
3 0

NO, they should not. Erythrocytes, leucocytes, and proteins (albumin) are not small enough to pass through the capillaries of the glomerulus unless there is damage to the glomerulus. However, glucose does pass through into the glomerular filtrate. Nonetheless, glucose is fully reabsorbed back in the proximal convoluted tubule (unless you have severe diabetes).






You might be interested in
What is a gag law?
lawyer [7]

Answer:

A rule that prevents government from passing new legislation.

Explanation:

3 0
1 year ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Homeostasis Worksheet Always graph time on the horizontal (X) axis. Label your axes Problem 1: A patient's body temperature was
marta [7]

Answer:

If temperature drops, it is negative feedback whereas if the temperature increases, it is positive feedback.

Explanation:

When the temperature drops from 98.30 °F, it means it is a negative feedback because its response is negative while if the temperature increases from 98.30 °F, it means it is a positive feedback because its response is positive. From 12 am to 3 am which represents negative feedback, temperature decreases whereas from 3 am to 6 am, the temperature increases which indicates positive feedback. From 6 am to 9 am, again the temperature drops and this fall represents negative feedback and so on.

8 0
3 years ago
Following a cut or scrape what process repairs your skin?
brilliants [131]
Following a cut or scrape ....
A Mitosis.
....repairs your skin
5 0
3 years ago
Read 2 more answers
Which statements accurately describe how fructose metabolism in the liver differs from glucose metabolism?
laiz [17]

The fructose 1-phosphate pathway can deplete intracellular phosphate/ ATP.

Explanation:

Fructose 1-phosphate is a derivative of fructose. For understanding in better way fructose metabolism has three enzymes. Fructose- bisphosphate aldolase B, fructokinase and Adenosine triphosphate. These all are present in liver and kidney of human as well rat. In liver rapidly fructose is change to fructose 1 through fructokinase.

After it is converted into trioses dihydroxyacetone phosphate as well as glyceraldehyde through aldolase.  With glucose metabolism Fructose get synergistic effect

7 0
2 years ago
Other questions:
  • Q4.10. Marathon runners can lose a great deal of Na* (through sweat). Some runners
    15·1 answer
  • How are the energy needs of plant cells similar to those of animal cells how are they different
    8·2 answers
  • Which of the following is NOT one of the structures of the excretory system?
    14·1 answer
  • A student is studying plant cells under a microscope. She observes one set of
    12·1 answer
  • Why have pesticide producers failed to produce new mosquito-killing insecticides in recent years?
    14·1 answer
  • Compare and contrast histosols and ardisols, the soils of bogs and peat marshes versus those of deserts and arid regions respect
    14·1 answer
  • What is dna replication?
    10·1 answer
  • A cell that has 6 chromosomes in the G2 phase will have how many sister chromatids during that same phase
    11·1 answer
  • PLA HELP IN EXAM NOW!!!!
    13·2 answers
  • Part 2: Water Cycle
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!