1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rudiy27
3 years ago
9

How do scientists solve problems?

Biology
1 answer:
nignag [31]3 years ago
3 0

Answer:

By using the scientific method

Explanation:

observation.....hypothesis......experiment.....and finally a conclusion

You might be interested in
What kind of macromolecule is lactose? how do you know? (the 4 macromolecules are 1)carbs 2)lipids 3)amino acids and 4) nucleic
vlada-n [284]

1) It's a Carbohydrate..

'Cause we know, when complex carbs digests, it breaks down into smaller particles and lactose is one of them

6 0
3 years ago
How many kingdoms are there in the domain Eukarya​
Marina CMI [18]

Answer:

five kingdoms

Explanation:

members of the domain eukaryotes have member-bound organelles including a nucleus containing genetic material and are represented by five kingdoms.

4 0
3 years ago
Why is soil important to plants?
Aloiza [94]

Answer:

A. it provides them with nutrients

Explanation:

4 0
3 years ago
Read 2 more answers
What does 7263×27 equal
dezoksy [38]

Since it is easily calculated using a calculator, I assume you need this done in the head.

Yes, you can do that.

It takes a few words to explain this, but if you understand how this is done, it goes fast.


27=3*9

so 7263*27 = (7263 * 3) * 9

so first multiply 7263 by 3.

72*3=216, 63*3=189

so 3*7263=21789

So far so good.

Now you can multiply anything by nine by subtracting from the right neighbour, starting from the right.

For example, 27*9. the right neighbour of 7 is 0, borrow 1, so 10-7=3

the right neighbour of 2 is 7, but we borrowed 1, so 6. 6-2=4

At the beginning of the number 27, we add a zero which we subtract from the right neighbour 2 to get 2.

So 27*9=243.

Now for 21789, we have successively

(10)-9=1

8-8=0 (9 was borrowed to become 8)

8-7=1

7-1=6

(11)-2=9

and finally

1 -0 = 1 (2 was borrowed to become 1)

So the final answer is 196101

6 0
3 years ago
8) Index fossils, such as the one in the diagram, are useful to geologists for
cestrela7 [59]
Because it the answer that it can help you if you get op
7 0
3 years ago
Other questions:
  • Almost half the birds in the yard were brown cardinals and the rest were bright red cardinals, so jimmy perceived them as two di
    6·1 answer
  • During aging, bone marrow is increasing replaced with _____."
    11·1 answer
  • The vertebrates in which blood flows directly from respiratory organs to body tissues without first returning to the heart are t
    14·2 answers
  • Approved eye protection devices (such as goggles) are worn in the laboratory
    11·1 answer
  • What are some key differences between plant cells animal cells and bacteria cells
    13·1 answer
  • Help! will mark brainliest
    10·1 answer
  • Why does U.S. e-waste get sent overseas?
    13·1 answer
  • How many trophic levels are there in the following food web?
    15·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • How does chemical weathering change the rocks or landscape?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!