1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksju [112]
4 years ago
7

Really need help plz

Biology
1 answer:
katrin [286]4 years ago
6 0
Such a miniscule amount of light penetrates beyond a depth of 200 meters<span> that photosynthesis is no longer possible. </span>
You might be interested in
Which pieces of information do you need to locate a particular star on a star
Kazeer [188]

Answer:

A:the star's size

Explanation:

4 0
3 years ago
A material you are testing conducts electricity but cannot be pulled into wires. It is most likely a _____.
Arturiano [62]
It is probably a metalloid
6 0
3 years ago
Read 2 more answers
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Describe the cycling of carbon in the carbon cycle as it passes through the living and non-living components of the ecosystem.
Tpy6a [65]

Answer: Photosynthesis, Decomposition, Respiration and Combustion

Explanation:

3 0
3 years ago
Help!!! will give brainlyest
worty [1.4K]
I think it’s c let me know if i’m wrong
8 0
3 years ago
Read 2 more answers
Other questions:
  • Complete a cross between two organisms that are both heterozygous for Black fur (Bb which is dominant over white fur). Use a Pun
    12·1 answer
  • "Scientific knowledge builds upon previous knowledge."
    6·1 answer
  • Some viruses attack cells by inserting their own dna into the host cells dna why might it be simpler for these viruses to attack
    7·1 answer
  • ¿Qué órganos constituyen el sistema respiratorio?
    10·1 answer
  • Sulci are: A. found only in the cerebrum. B. the cracks between the bumps on the brain. C. the bumps on the surface of the brain
    6·1 answer
  • Waves cause erosion through the processes of ______ and abrasion. a. chemical weathering b. impact   ​
    6·2 answers
  • The "vital centers" (cardiac, respiratory, vasomotor centers) are located in the: select one:
    15·1 answer
  • compara la funcion del ADN con los planos de una casa. ¿como saben las celulas de un organismo que parte del cuerpo pueden tomar
    9·1 answer
  • Which kind of environmental change would a tomado be?
    5·1 answer
  • Which of the following best describes protein synthesis?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!