1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lapo4ka [179]
2 years ago
13

Monocots typically have leaves with _________ veins and flowers with ______ parts per whorl.

Biology
1 answer:
ivann1987 [24]2 years ago
6 0

Monocots<span> have distinct structural features. L<span>eaf veins of the monocots are parallel. Flower parts are in multiples of three per whorl. Stems have no pith region.  Other characteristics of monocots are: its embryo is with a single cotyledon and its pollen is with single pore. </span></span>

You might be interested in
Lactic acid fermentation can be modeled by which equation?
Reptile [31]

Lactic acid fermentation can be modeled by the following equation: Pyruvic acid + NADH → Lactic acid + NAD+

LACTIC ACID FERMENTATION:

  • Fermentation is a process undergone by some anaerobic organisms. Ideally, the process of cellular respiration proceeds as follows in the presence of oxygen: Glycolysis- Kreb cycle - ETC.

  • However, in the absence of oxygen (anaerobic condition), the product of glycolysis which is pyruvic acid combines with an electron carrier (NADH) to give rise to lactic acid and NAD+.

  • This means that pyruvic acid is reduced while NADH is oxidized as modelled in the following equation:

  • Pyruvic acid + NADH → Lactic acid + NAD+

Learn more at: brainly.com/question/11502989?referrer=searchResults

4 0
2 years ago
Pls help me its for a text and i donr want to fail
adell [148]
ANSWER: The daylight and nighttime hours are equal.

Explanation: resulting in a "nearly" equal amount of daylight and darkness at all latitudes. These events are referred to as Equinoxes. The word equinox is derived from two Latin words - aequus (equal) and nox (night).
8 0
3 years ago
A long time ago, farmers discovered that if they grow the same
levacccp [35]

Answer:

Because they don't have fertilizer.

Explanation:

Well, if this was a long time ago, then farmers did not have fertilizer. So, there are bacteria on the roots of plants that convert nitrogen into a usable form. It's very important for growing, and when farmers harvest the crop, not much of the nitrogen is returned to the land, so it is not as fertile. Fertilizer is largely consisted of nitrogen, so that is why farmers use fertilizers today. But "a long time ago," farmers did not have fertilizer.

5 0
2 years ago
What part of the eye touches the air?​
AlexFokin [52]
The cornea is the only part of the eye that touches air.
7 0
3 years ago
Read 2 more answers
Are paramecium heterotrophic or autotrophic? Explain your answer.
Ivahew [28]

Answer: Paramecium are heterotrophs.

Explanation: Their common form of prey is bacteria. A single organism has the ability to eat 5,000 bacteria a day. They are also known to feed on yeasts, algae, and small protozoa.

Hope this will help

8 0
3 years ago
Read 2 more answers
Other questions:
  • In modern classification system, unicellular organisms that contain chloroplasts and a nucleus would be considered; A) annelids
    14·1 answer
  • PLEASE HELP Fermentation is also called
    13·1 answer
  • Which of the following statements apply to the variation in human skin color?
    11·2 answers
  • The body attempts to fight off an infection by       plz help
    10·2 answers
  • True or false meiosis produces somatic cells like eggs and sperm cells
    10·2 answers
  • How are prokaryotic cells and eukaryotic cells different?
    12·2 answers
  • Lizette’s teacher suggests that she use a strong solution of vinegar to kill the weeds. Vinegar is acidic and prevents plants fr
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Please help me I’m having so much trouble with this
    5·2 answers
  • I need help please!!!
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!