1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wel
3 years ago
15

An oncogene is: Select one:

Biology
2 answers:
Sholpan [36]3 years ago
5 0
D because a oncogene is a cell that creates cancer cells or tumors
Anna007 [38]3 years ago
3 0

Answer:

I think it is A. I'm only guessing because I have never heard of an Oncogene before.

You might be interested in
When a fruit is being formed what type of vascular tissue transports the glucose into the fruit?
maksim [4K]
In times of rapid photosynthesis, the main product is glucose<span>, but it is usually converted ... the sugar is </span>being<span> used (the sink) whether it is up or down the stem of the plant. ... This theory suggests that the sucrose is transported </span>into the fruit<span> by active.!</span>
4 0
3 years ago
Type the correct answer in each box. The atomic number of sodium (na) is 11. The element phosphorous(p) is the fourth element to
alexgriva [62]

Answer:

The atomic number of phosphorus is 15. It has zero charge because it has 15 electrons.

7 0
4 years ago
Atherosclerosis predisposes to a number of processes that are factors in myocardial ischemia. These processes include1. Hemorrha
77julia77 [94]

Answer: Thrombus Formation

Explanation:

Atherosclerosis is a chronic, progressive disease in which the plaques starts building in the walls of artery. These plaques are the deposition of the cholesterol and other lipids, calcium and inflammatory cells known as macrophages.

Once these substances starts depositing in the artery it can lead to thrombus formation which is not cured by itself.

The Atherosclerosis is the predisposes to the thrombus formation which can cause myocardial ischemia.  

6 0
3 years ago
Read 2 more answers
Help need help please!!
kumpel [21]

Answer:

I am not too sure but maybe A?

Explanation:

Because plants are part of the biosphere and land is part of the geosphere

I am sorry if it is wrong

7 0
3 years ago
Read 2 more answers
The arrow in a chemical equation means ________
allochka39001 [22]

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

Answer: It indicates the direction of the reaction

I hope this helped!

<!> Brainliest is appreciated! <!>

- Zack Slocum

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

4 0
3 years ago
Other questions:
  • you are studying the relationship between the type of shoe a person where is it how far they can slide down the hallway. The dat
    7·2 answers
  • Which structure connects an ovary to the uterus?
    15·2 answers
  • Which era lasted from 542 to 251 mya
    6·1 answer
  • What is the function of the cell membrane? A. To determine what materials can enter or leave a cell B. To package proteins in an
    12·2 answers
  • The inner planets of the Solar System are A. the four planets that are nearest to the Sun. B. the six planets that are nearest t
    5·2 answers
  • What manufactures organic compounds in cells
    13·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • What does it mean to partition something?
    6·1 answer
  • Interpret the Punnett square. A Punnett square with four rows and four columns. The first row is labeled big-A, big-B. The secon
    12·1 answer
  • Sam is 5'1, she wants to know how tall she is in meters
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!