1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nadusha1986 [10]
3 years ago
6

Michael wants to test the effect of stomach acid concentration on the solubility of a particular oral medication. Which experime

ntal design setup would best help him answer his question?
Biology
1 answer:
Airida [17]3 years ago
7 0

Prepare solutions of different acid concentrations, measure 50 mililiters of each into different beakers, and place the same type of pill of the same mass into the beakers

Explanation:

You might be interested in
What was Charles Darwin's scientific breakthough?
dimaraw [331]
Evolution or Natural Selection fam ;) 

If all else fails, moms spaghetti

6 0
3 years ago
Read 2 more answers
Does anyone have the answer key to biology semester 1 final exam study guide review 76 questions
andrey2020 [161]

Answer:

this one only has 61 but hope this helps

Explanation:

its on quizlet just look up the name of what ur   looking for

5 0
3 years ago
When joints are not regularly moved through their entire range of motion, muscles and ligaments eventually _____. a. shorten b.
zhuklara [117]

Answer:

a. shorten

Explanation:

Inability or failure for joints to move through their entire range of motion is caused by constrictions. These constrictions often results when the excess adipose tissues that surrounds the muscles and ligaments are not in required adequate proportion. These constrictions can be caused by ageing, fatigue, muscular diseases etc. As a result of these constriction in the joints, let say for example, the knee joint, the muscle and ligaments tends to shorten in length.

7 0
3 years ago
Humans cannot digest food without the aid of small single-celled organisms that live in our digestive tract. These small organis
OverLord2011 [107]
Enzymes. There are 3 main types: Peptidase, Lipase, and amylase :) hope that helps! I'm learning that stuff too :)
3 0
3 years ago
Imagine you work for an online support site for gardening. Below is an email you receive from a customer Based on the informatio
zepelin [54]

Answer:

by Planting the Right Way

Explanation:

advise people to plant.

plant by yourself so people do the same.

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The largest amount of air pollution comes from ?
    11·1 answer
  • Mutations in several different genes that encode enzymes in the pathway for the synthesis of the heme group may cause a genetic
    13·1 answer
  • A population of lizards lives in a rocky area next to a desert. Some lizards are light colored and blend into the sand. Others a
    15·1 answer
  • What is the agricultural practice that focuses on the economic viability of crops and the use of non-renewable resources effecti
    15·2 answers
  • Which word of the poem are an example of a simile
    6·2 answers
  • In 1953, Stanley Miller and Harold Urey built a model of Earth's early
    6·1 answer
  • QUESTION 1
    7·1 answer
  • Its supposed to be a cell analogy, help please. :)​
    7·1 answer
  • Identify the process in Model 2 that describes an artificial (purely human-caused) process that moves carbon.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!