1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anika [276]
3 years ago
10

Protists can be found ??

Biology
2 answers:
WITCHER [35]3 years ago
8 0
They can be found in all of those places, but are best suited to moist areas. c:
antoniya [11.8K]3 years ago
5 0
I am not sure protist can be found in wet and moist areas. So i think protist can be found in all of the above choices that are mentioned.
You might be interested in
Control-part of the body that determines what to do with the information about the change in setpoint (I will give brainliest)
Ann [662]

Answer:

Hypothalamus

Explanation:

The hypothalamus is involved in different daily activities like eating or drinking, in the control of the body's temperature and energy maintenance, and in the process of memorizing and in stress control. It also modulates the endocrine system through its connections with the pituitary gland.

4 0
2 years ago
Select the two terms that correctly complete this statement. Observable traits exhibited by an organism do not always indicate t
dsp73
Select the two terms that correctly complete this statement. Observable traits exhibited by an organism do not always indicate the exact genetic makeup of
that organism because of recessive alleles and <span>polygenic traits</span>. 
5 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
The Jones family of Jacksonville would like to live more sustainably by reducing their fossil fuel use. They already carpool and
gizmo_the_mogwai [7]

Answer:

D. Planting exotic shade plants in their yard and hiring a lawn company to tend to them.

Explanation:

Both grass and vegetables produce CO2. Vegetables produce as much CO2 as a car that's been driving 4.5 miles. Beef produces enough CO2 for 63 miles. This eliminates all of the answers except for D. Plants use CO2 in photosynthesis and give off O2. So not only will is reduce the CO2 output, it will provide you oxygen.

5 0
2 years ago
Refer to Figure 12-2. Which of the following is the series of amino acids encoded by
svetlana [45]

Answer: D

Explanation:

Okay so look at the diagram. Start from the middle and work your way out.

AUG: I find A in the middle (the first four) and then go to the part of the diagram that has U right under the last letter you had, so A. And do the same for U, and you should get methionine.

Repeat this process for the other two.

6 0
2 years ago
Other questions:
  • Scientists are constantly learning more and more about fossils because
    8·2 answers
  • I Need help asap please help i will give lots of points
    12·2 answers
  • Which of the following is a contributing reason behind emerging disease?
    14·1 answer
  • Name the three types of muscles
    5·2 answers
  • What is the starting point of all food chains/webs?
    14·2 answers
  • Difference between Ecological Succession and Degradation?
    13·1 answer
  • In some cattle, the genes for red hair and for white hair are codominant. Cattle with alleles for both red and white hair have b
    6·2 answers
  • Match with the correct pattern of inheritance.
    7·1 answer
  • How does wind affect the amount of rain?
    15·2 answers
  • Which of the following is true about a sea star's DNA?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!