1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anika [276]
3 years ago
10

Protists can be found ??

Biology
2 answers:
WITCHER [35]3 years ago
8 0
They can be found in all of those places, but are best suited to moist areas. c:
antoniya [11.8K]3 years ago
5 0
I am not sure protist can be found in wet and moist areas. So i think protist can be found in all of the above choices that are mentioned.
You might be interested in
A heterotroph is an organism that
MatroZZZ [7]
Heterotroph organism are organism that cannot make its own food such as lions and cats
6 0
4 years ago
10. Systematists categorize all living creatures into what three domains?
Musya8 [376]
The correct answer for this question would be option B. Systematists categorize all living creatures into three domains namely bacteria, archaea and eukarya. This is a<span>ccording to the Woese system which is introduced in 1990. Both Archaea and Bacteria are classified as prokaryotes or single-celled organisms. Hope this answer helps.</span>
5 0
3 years ago
The weakness of hydrogen bonds between the bases of DNA allows what?
Rufina [12.5K]
The weakness of hydrogen bonds between the bases of DNA allow DNA to separate. DNA needs to be able to separate so it can duplicate.
4 0
3 years ago
Scientists have genetically engineered certain species to be more resistant to freezing temperatures. This was accomplished by s
beks73 [17]

Answer:

genes

Explanation:

5 0
4 years ago
Explain what happens to the mass during photosynthesis and cellular respiration
Free_Kalibri [48]
<span>Photosynthesis makes the glucose that is used in cellular respiration to make ATP. The glucose is then turned back into carbon dioxide, which is used in photosynthesis. While water is broken down to form oxygen during photosynthesis, in cellular respiration oxygen is combined with hydrogen to form water.</span>
4 0
3 years ago
Other questions:
  • After spending several hours outdoors, your skin is pale and clammy. you feel weak and have muscle cramps. these are symptoms of
    5·1 answer
  • When the blood becomes acidic (acidosis) and bicarbonate ions have been depleted, new bicarbonate ions must be generated in the
    12·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Brainest for best response!
    7·2 answers
  • HELP. can someone please answer these questions for me.
    14·1 answer
  • Amylose is a form of starch made up of α glucose monomers that are bound by 1-4 linkages. How would the molecule be affected if
    13·1 answer
  • All 4 of the macromolecules that make up living things are all _____ based
    7·1 answer
  • The correct answer will get Brainliest. Choose all the answers that apply.
    9·2 answers
  • What is the process that the tree uses to get its energy called?Does this process directly or indirectly affect the energy needs
    10·1 answer
  • The electromagnetic force is felt by
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!