1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
galben [10]
3 years ago
11

Artificial selection is

Biology
1 answer:
STatiana [176]3 years ago
6 0
Artificial Selection is the intentional breeding for certain traits.
You might be interested in
List the three types of treatment for a fracture or dislocation
tatuchka [14]
A fracture or dislocation is a break or crack in the bone. It is when two bones are out of place at the joint that connects them which may also cause injury to nerves and blood vessels. The types of fracture are: Closed refers to fracture that does not break skin, Open, a fracture where external wound associated with fracture, Non displaced, a simple crack of bone and the Displaced, a fracture in which there is actual deformity. But there are three types of treatment for fracture or dislocation namely: Open treatment, examples are Surgically Cleaning the Bone, Removing Contaminated or Non-Viable Tissue, Stabilizing the Bone and many more. Other type of treatment is closed treatment like No immobilization and Cast Immobilization. Third type of treatment is Percutaneous Skeletal Fixation like internal and external fixation.

5 0
3 years ago
Inbreeding does not change allele frequencies and ________ the relative number of heterozygotes. A. decreases B. increases C. ma
horsena [70]
The answer is:
A. decreases.
8 0
4 years ago
Covalent or ionic: transfer of electrons<br> covalent or ionic: sharing of electrons
belka [17]

When two atoms react, they form either of two kinds of bond, ionic bonds or covalent bonds.

Ionic bonds are the type of bonds where there is transfer of electrons from one atom to another.  The electrons are removed and from one atom and attached to  another. A good example is salt which is composed of sodium and chlorine. Sodium readily loses one of its electrons and chlorine readily accepts it. Before losing the electron, sodium has a positive charge, but then becomes negatively charged after giving up the electron. Chlorine has a positive charge before gaining the electron but becomes negatively charged after gaining the electron. These opposite charges between sodium and chlorine attract the two elements together to form the ionic bond.

Covalent bonds are the kind of bonds formed when two atoms share electrons. Here there is sharing, none of the atoms loses an electron and none gains. A good example is water which is formed when oxygen  shares two electrons, each with an atom of hydrogen.

 The Oxygen atom forms two covalent bonds with the pair of hydrogen atoms.

6 0
3 years ago
I’ll give u a brainlist if u tell me the right answer and explain
anastassius [24]

Answer:

B- nucleus

Explanation:

4 0
3 years ago
Read 2 more answers
Lipids commonly provide ______ energy to the body.
coldgirl [10]

Answer:

Most of the energy required by the human body is provided by carbohydrates and lipids. As discussed in Chapter 3 "Carbohydrates", glucose is stored in the body as glycogen. While glycogen provides a ready source of energy, lipids primarily function as an energy reserve.Aug 13, 2020

Explanation:

6 0
4 years ago
Read 2 more answers
Other questions:
  • The inductive method of investigation performs experiments or makes an observation to prove or disprove a suggested theory. True
    5·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Which 3 are correct?
    9·1 answer
  • Compare marshes, swamps, and bogs.​
    11·2 answers
  • What has changed in this room since you walked in?
    6·1 answer
  • What is the purpose of colorful petals?
    5·2 answers
  • Can you pls help me. Question: Water is moved in surface currents in the ocean. Identify the source of energy for surface correc
    10·1 answer
  • ¿Qué tipo de estrategia reproductiva presenta el sapo?
    11·1 answer
  • Describe the route taken by oxygenated blood from the lungs to the body cells
    6·1 answer
  • Describe how alveoli are adapted for gas exchange( 4 marks)​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!