1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
german
3 years ago
7

The cranium is connected to the____ bones

Biology
2 answers:
boyakko [2]3 years ago
6 0
To the occipitial bones
hope I helped u
Lina20 [59]3 years ago
3 0
Connected to the occipital bones
You might be interested in
What do fats, steroids, and waxes have in common? What do fats, steroids, and waxes have in common? (a) Moderate polarity. (b) L
hodyreva [135]

Answer:

Both (b) and (c)

Explanation:

Fats, steroids and waxes are some of the most common types of lipids. Lipids are non-polar hydrocarbons because of the presence of non-polar carbon-carbon and carbon-hydrogen bonds in there structure.

Generally, polar molecules are soluble in water while non-polar molecules are insoluble in water, hence, lipids do not dissolve in water. There non-polarity also makes them a suitable component in the selectively permeable biological cell membrane.

3 0
3 years ago
2. Ms. L's respiratory function was evaluated by quantifying different lung volumes and capaci-
Sphinxa [80]

Based on respiratory function tests, the correct options are:

  • spirometer.
  • vital capacity
  • residual volume.

<h3>What is a respiratory function tests?</h3>

A respiratory function test is a test done to evaluate the ability of the lungs to take in air and remove carbon dioxide

The machine used for this test is called a spirometer.

Therefore;

  • Ms. L's respiratory function was evaluate using a machine called a spirometer.
  • The amount of air that can be expelled by maximum ex-halation after maximum inhalation is termed the vital capacity
  • An increase in the amount of air remaining in her lungs after a normal expiration is called the residual volume.

Learn more about respiratory function test at: brainly.com/question/18117969

#SPJ1

3 0
2 years ago
In which of the following situations would exocytosis be the proper mechanism of membrane transport?
cluponka [151]

Answer:

Secretion of the neurotransmitter serotonin, which is a water-soluble amine molecule

Explanation:

Exocytosis is defined as the process where cell transports secretary products which are packaged in transport vesicles such as antibodies, peptide hormones, secretory proteins, and enzymes with the help of cytoplasm to the plasma membrane.

Some example of exocytosis are:

1) Neurotransmitters secrets from nerve cells.

2) Antigens which helps to stimulate the immune response.

3) Proteins of the plasma membrane.

8 0
2 years ago
Read 2 more answers
What types of natural pollution?
Drupady [299]
Burning fossil fuels
8 0
3 years ago
The wings of a bat and the wings of a bird are an example of convergent evolution. true or false
VARVARA [1.3K]

Answer:

Birds and bats have homologous limbs because they are both ultimately derived from terrestrial tetrapods, but their flight mechanisms are only analogous, so their wings are examples of functional convergence.

6 0
2 years ago
Read 2 more answers
Other questions:
  • using the gas pedal analogy explain the impact on the cell cycle of a proto-oncogene versus an oncogene
    12·1 answer
  • Earth travels around the Sun at about 67,000 miles per hour. Earth's motion, therefore, is an example of _____.
    6·2 answers
  • Can bacteria be viewed with a light microscope?
    11·2 answers
  • How does mutation enable viruses to continue causing disease?
    13·1 answer
  • The structure of the cell membrane was discovered in 1895 by _________. Finding a similarity to Olive Oil, he discovers membrane
    10·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Pls help...Henry is studying a family of tree frogs that have poisonous skin, and he finds one frog with a mutation for the pois
    11·2 answers
  • Which farm animal has the largest eyes of any land mammal?
    7·1 answer
  • What adaptations of large herbivores allow them to live in the taiga? (Select all that apply.)
    8·1 answer
  • If a person uses up his or her reserve supply of glycogen and still does not eat, sugar comes from the?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!