1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hodyreva [135]
2 years ago
12

Materials are transported within a single-celled organism by the

Biology
1 answer:
olga_2 [115]2 years ago
6 0
The cytoplasm transports materials within a single celled organism. 
I hope this helps

You might be interested in
Help pls i will mark brainiest​
Natasha2012 [34]

Answer:

Water, Sunlight, and Oxygen = Abiotic While Consumers and Producers are Biotic

Explanation:

Because biotic is LIving and Abiotic is Non-Living.

Tell me If this helps!

8 0
1 year ago
How do both similarity and differences among amino acids allow them to form macromolecules with a wide variety of properties
ioda
The R group is what allows amino acids to form macromolecules with different properties. every amino acid has the same basic structure, the only difference is what the R group is made up of. The similarities allow the amino acids to form a chain while the differences allows them to have different functions. Hope this helped!
3 0
2 years ago
Approximately 90 percent of all living plants are
marusya05 [52]

Answer:

Approximately 90% of all living plants are group of Angiosperm

3 0
3 years ago
8. The diagram below shows the shift in the spectrum for hydrogen light from several different sources in the universe.
igor_vitrenko [27]

Answer:

more distant galaxies are moving away faster.

the shift towards red (Doppler effect like with sound on Earth) is the indication.

Explanation:

what did this have to do with biology ?

and by the way, this is also something I debate severely in scientific communities, because yes, the red shift is there. but "more distant" also means "more in the past", so that the data shows us actually that things in the past moved faster away. not necessarily today ...

5 0
2 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Other questions:
  • In healthcare settings where sterilization is an absolute necessity what method of sterilization will typically be used?
    14·1 answer
  • Government programs to reduce acid rain have resulted in cleaner emissions from u.s. industries in recent years. as a result, th
    15·1 answer
  • Suggest why many globular proteins in contrast to fibrous proteins have catalytic or regulatory role
    11·1 answer
  • Which statement best describes a climax community? Hurry PLZ ITs A TEST!!!
    5·2 answers
  • The adult technique for cpr is used when a victim is this age
    9·1 answer
  • Who is likely to show the greatest amount of creative productivity?
    11·1 answer
  • How does a convection current transport energy around the globe
    8·1 answer
  • A house cost $120,000 when it was purchased. The value of the house increases by 10% each year. Find the rate of growth each mon
    6·1 answer
  • Which ancient culture is not know for using geothermal energy?
    13·2 answers
  • All virses have a what
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!