Answer:
The normal pattern for most compounds is that as the temperature of the liquid increases, the density decreases as the molecules spread out from each other. ... The ice structure takes up more volume than the liquid water molecules, hence ice is less dense than liquid water.
1 the atmosphere because gas is everywhere.
When climbing a mountain, we can observe transitions in biological communities that are analogous to the changes in biomes at different latitudes.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
This condition is known as a super oxide in which mutated enzyme extremely functional because it helps in production of cells .
when unstable molecules that contains oxygen and that easily react with other molecules in the cells. a build up of reactive oxygen species and cells causes damage of DNA ,RNA & protein ,which cause cell death.
super oxide refers various toxic oxygen containing free radicals such as monovalant anion O2 (negative) or that compound containing potassium super oxide KO2. reactive oxygen can cause damage to the basic building block of the cell. DNA damage can occur in the form of double stranded breaks as a result of reactive oxygen induced conversion of guanine to 8-oxo guanine.
To learn more about the cell death here
brainly.com/question/14263310
#SPJ4
