1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
worty [1.4K]
4 years ago
11

How does oxygen move through the blood?

Biology
1 answer:
Bond [772]4 years ago
3 0

Answer:

Attached to hemoglobin.

Explanation:

The oxygen is important for the cellular functioning of cell. The carbon dioxide must be move out of the cell and oxygen should reach to each and every cell of the body.

Hemoglobin molecule has the ability to binds with the four molecules of oxygen. The oxygen moves in the body by binding with the hemoglobin molecules present inside the red blood cells.

Thus, the correct answer is option (a).

You might be interested in
According to the energy pyramid, the
Viefleur [7K]
C .. please give thanks
8 0
3 years ago
Read 2 more answers
What change is observed in leukocytes during an allergic disorder (type I hypersensitivity) often caused by asthma, hay fever, a
blagie [28]

Answer:

Increase in eosinophils.

Explanation:

The leukocytes are the white blood cell that plays an important role in the immune system. The white blood cell include eosinophil, basophil, neutrophil and monocytes.

The allergic reactions that are caused by hay fever or asthma is marked by the excess increase in the number of eosinophils in the body. The eosinophils are the first to reach at the site of parasitic infections and protect the body during the allergic reactions.

Thus, the answer is eosinophils.

5 0
3 years ago
How do light microscopic differ from electron microscope?
rosijanka [135]

Answer:

B

Explanation:

This is the answer that I think is correct

5 0
4 years ago
Water has the ability to store heat longer than other substances. What benefit does this property of water provide to organisms?
eduard

Answer:

B.

Explanation:

The resistance to sudden temperature changes makes water an excellent habitat, allowing organisms to survive without experiencing wide temperature fluctuation. Furthermore, because many organisms are mainly composed of water, the property of high heat capacity allows highly regulated internal body temperatures.

I'm pretty sure it's B . If I'm not I'm very sorry as I copied this from my textbook .

7 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • The benefits of brain plasticity are most clearly demonstrated in
    15·1 answer
  • Why do atoms gain, lose, or share electrons?
    12·2 answers
  • What are the two jobs of the cytoskeleton
    7·1 answer
  • Examples of different ways that observations can be used in scientific inquiry
    11·1 answer
  • Which of the following best describes how the
    7·1 answer
  • In which way does the circulatory system rely on the skeletal system
    14·1 answer
  • Which of the following is not an accurate portrayal of antisocial personality disorder?a.People with this disorder suffer little
    6·1 answer
  • OLEAS EHELP!!!
    11·1 answer
  • Use the pie chart to answer the question below.
    10·2 answers
  • Which components are needed for the expression phase of the crispr-cas system?.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!