1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timurjin [86]
3 years ago
12

The Ellele for tall pea plants is dominant over the allele for short pea plants. what must be true for a cross between a tall pl

ant and a short plant to produce any short plants ?
Biology
1 answer:
Sedbober [7]3 years ago
3 0
The reason I said that you are wrong is because no


You might be interested in
Is color blindness genetic or chromosomal?
tino4ka555 [31]
Color blindness is (from what I've learned) <span> a genetic disorder that only males get because it is carried on by the y-chromosome. About females, I don't really know the point, but there are t</span><span>hree genes responsible for color vision lie in the rod cells of the retina and were discovered by Jeremy Nathans at Stanford during his graduate work in the laboratory of Lubert Stryer. </span>
7 0
3 years ago
The number of wild horses per square kilometer in a prairie is the horse populations is called
Gwar [14]

Answer:

Population density of horse

Explanation:

Population density refers to the number of people (or any other living species) existing in a particular area. This reflects the quantity of a particular type of living species that exist over an area of about 1 km².

Population density is obtained mathematically by, dividing the total population of the area by the total size of the area.

In the given question, it describes the quantity (number) of wild horses that are present per square kilometer in the prairie lands. This refers to the population density of horses.

7 0
4 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Overlearning"" in habituation (or below-zero habituation) can occur if __________________. A. several different stimuli are used
katen-ka-za [31]

Answer:

C. habituation trials continue after the response has disappeared.

Explanation:

habituation involves the complete elimination of a particular response (i.e, zero frequency of occurrence). If the stimulus cintinues to be presented for an additional number of trials, then, although no further changes occur, the response will exhibit lower levels of recovery (e.g, spontaneous recovery is reduced) as if the response would have fallen below a zero frequency.

4 0
3 years ago
What Are two functions regulated by the cerebrum ?
Blizzard [7]
Thought and action are the two main functions
6 0
3 years ago
Read 2 more answers
Other questions:
  • The belief that genotype expression depends on environmental experience and how we respond to the environment depends on the gen
    7·1 answer
  • Which best defines homeostasis
    5·2 answers
  • What type of caterpillar is this
    15·2 answers
  • If an egg cell containing the (n+1) number of chromosomes combines with a sperm cell containing the (n) number of chromosomes, w
    8·2 answers
  • Which is true of solar, wind, and geothermal energy
    15·2 answers
  • A 20-year-old college student has presented to her campus medical clinic for a scheduled Papanicolaou (Pap) smear. The clinician
    15·1 answer
  • PLEASE ANSWER!!!!!!! What is true about the lagging strand during DNA replication?
    5·1 answer
  • To qualify for the office manager's job, 55-year-old Mariel must take a series of psychological tests. Her performance on the te
    14·1 answer
  • How is a recessive allele different from a dominant allele?
    15·2 answers
  • In a typical barrel of oil, roughly what percent will be refined into gasoline?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!