1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
grin007 [14]
4 years ago
14

Which nervous system controls the voluntary function of the limbs and the sense organs?

Biology
1 answer:
Tomtit [17]4 years ago
8 0
<span>The nervous system that controls the voluntary functon of the limbs and the sense organs is called the Autonomic nervous system. The Autonomic nervous system is make up of both, the Parasympathetic nervous system and the Sympathetic nervous system.</span>
You might be interested in
Is a straw a good model for showing the malleability of copper?
Oksi-84 [34.3K]
No, it needs to be a metal in order to show the malleability of copper.
8 0
3 years ago
Why are decomposers and detritivores essential parts of all food webs?
Vinil7 [7]

Answer: Detritivores improve the nutritional value and the texture of the soil: This makes the soil productive to plant life which translates to availability of food for the herbivores and carnivores like human beings. They however do not complete the energy cycle as their wastes are energy products that need to be decayed.

Decomposers help in converting the leftovers of animals and plants to useful substances for other living organisms. They are mainly bacteria and fungi. Have you ever wondered what would happen if the decomposers and consumers were not in the ecosystem?

Detritivores play a very important in the cycle as they are the consumers of dead leaves, old skin, carcasses and manure. They include millipedes, earthworms and slugs that feed on dead plants and animals but leave some parts and their feces that are converted to energy by the decomposers. Players in the energy cycle function hand in hand, a decomposer is found at the lowest part of the cycle as it deals with the remains. They complete the energy cycle. The roles of the decomposers and detritivores almost coincide.

Hope this helps !!! Good luck !!! ;)

8 0
3 years ago
In animals, carbon dioxide waste is exchanged for
LUCKY_DIMON [66]

Answer:

oxygen

Explanation:

  • Through the process of respiration , in lung the carbon dioxide from the blood is exchanged with oxygen.
  • The smallest dunctional unit if the lung is the alveoli
  • At this level the gases are exchange through the capillaries present close to the alveoli.
  • The concentration gradient ,meaning the greater amount of oxygen present in the lungs and greater amount of carbon dioxide in the blood creates a gradient that allow the movment of oxygen into the blood and carbon dioxide in the alveoli through the membrane .
  • Partial pressure created allows the easy movement .The carbon dioxide get into the trachea and expelled through nose and mouth.

3 0
3 years ago
When a tautomeric shift occurs, the resulting nulceotide is a(n) __________ of the nucleotide prior to the shift?
sdas [7]
It is the structural isomer. It is a type of isomerism in which particles with the same sub-atomic equation have distinctive holding designs and nuclear association, instead of stereoisomerism, in which sub-atomic bonds are dependable in a similar request and just spatial game plan contrasts.
6 0
3 years ago
Why would too much salt intake cause someone to develop high blood pressure?
aleksandrvk [35]

The right answer is A) Salt in the bloodstream causes fluids to enter the blood from surrounding cells, due to osmosis.

The circulatory system of the body is a highly flexible vascular system, which has the ability to open and distend new capillaries and veins in order to cope with an increase in fluid volume.

The term "Higher blood pressure" implies that an excess of salt leads to the retention of additional fluid within the arterial circulatory system, which would cause an increase in blood volume and add pressure to the walls. arteries.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Why does natural selection act on phenotype rather than genotype of an organism?
    6·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which two elements share similar properties?
    6·1 answer
  • Why some plants may benefit more than others to certain variable
    11·1 answer
  • Pleaseee answer ASAP 15 points if answer
    8·1 answer
  • In the cells of the human body, oxygen molecules are used directly in a process that (1) releases energy (2) digests fats (3) sy
    9·1 answer
  • A man has hemophilia, but his parents do not. Using H for normal and h for hemophilia, give the genotype of his father, mother,
    9·1 answer
  • In the early stages of development, the embryos of dogs, pigs, and humans resemble one
    13·1 answer
  • Which set of side lengths will NOT make a triangle?
    12·1 answer
  • Explain scientifically whether humans and humpback whales share a close evolutionary relationship. here are some ideas to consid
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!