1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kobotan [32]
2 years ago
9

Where on earth are cacao farms generally found?

Biology
2 answers:
Natalija [7]2 years ago
5 0
Ghana is were there mostly found, hope this helps, plz make brainly-est
miv72 [106K]2 years ago
4 0

The cocoa farms are generally found in the area called as the cocoa-belt. This cocoa belt is a narrow band of the land, which exists up to 20 degrees to the South and the North. Ghana and Indonesia are among the top cocoa growing countries. Warm and hot temperatures with high humidity and high rainfall are needed for the growth of the cocoa trees.

Hence, the answer is 'Cocoa trees grow in the cocoa belt which exists up to 20 degrees to the South and the North'.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
What are the four unifying principles that form the foundation of modern biology?
Vikentia [17]
Four unifying principles form the foundation of modern biology<span>: cell theory, evolutionary theory, the gene theory and the </span>principle<span> of homeostasis. These </span>four principles<span> are the founding principles of each category of biology</span>
5 0
3 years ago
Every cell contains certain structures that perform specialized functions for the cell. What are these structures called?
Elena L [17]
<span>Every cell contains certain structures that perform specialized functions for the cell. What are these structures called?

</span>b. organelles

7 0
3 years ago
Read 2 more answers
What phase of mitosis are the chromosomes taken from? Why?
arlik [135]

Answer:Metaphase

Explanation:

8 0
2 years ago
As an instructor for a class that assists individuals to become Master Gardeners, you are charged with answering the questions a
Snezhnost [94]
<h2>Biennial plants</h2>

Explanation:

This plant is a biennial, which means it will just take longer than a season to mature enough to produce flowers.

Since the Sweet William  plant did not flower last year when it was planted and this year also it did not bud till the spring. So, we can assume that these plant will need atleast two seasons to mature hence they are biennials.

Depending on the life span, plants are classified as annuals (one season), biennials(two season) and perennials (more than two years).

6 0
3 years ago
Other questions:
  • What part of the cell are xylem and phloem most similar to in function? A) Nucleus B) Lysosome C) Mitochondria D) Endoplasmic re
    7·2 answers
  • Wilhich features of the ocean floor are found in the open ocean?
    13·1 answer
  • Besides predators, there are other living organisms in an ecosystem that interact with a population that can cause natural selec
    15·1 answer
  • What characteristics does cold medicine have to have that allows it to be transported throughout the body?
    9·1 answer
  • What are 3 important trends in our solar system?
    7·1 answer
  • The process of grouping things based on their similarities
    13·1 answer
  • Humans should consider microbes as beneficial organisms for all of the following reasons except:
    12·1 answer
  • Cells and the organisms they make up reproduce through cell division. Some
    12·1 answer
  • Which of the following has a direct role in the nitrogen cycle?
    6·1 answer
  • 5. Waves that can travel with or witout a medium are called mechanical *
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!