1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkinab [10]
2 years ago
15

Under conditions when there is very intense competition between memebers of the same species the distribution of individuals wil

l tend to be:____.
Biology
1 answer:
user100 [1]2 years ago
8 0

As the intense competition of the species are observed in clumped distribution, so the answer is distribution of individuals will tend to be clumped.

<h3>What is intraspecies competition?</h3>

The competition which  occurs between individuals of the same species  based on common need for a limited resources,  leading to a reduction in the survival and reproduction rate.

Intraspecific competition for exploitation which is an indirect type  observed when an individual consumes the available resources.

Intraspecific competition by interference observed when the individuals fight to access for other's food.

Hence, answer is clumped.

Learn more about same species competition , here:

brainly.com/question/10218416

#SPJ4

You might be interested in
What makes a group of cells a truly multicellular organism?
Anna71 [15]
Multicellular organisms begin as a single cell. These cells then grow and undergo differentiation, the process by which cells develop specialized forms and functions.In multicellular organisms, cells are often organized into tissues, organs, and organ systems.
3 0
3 years ago
51. how do the differences in amino acid sequences lead to different protein functions?
Setler [38]

DifferentDifferent amino acid produce different proteins based on the bonds formed between them .

<h3>How does the sequence of amino acids affect the functions of protein ? </h3>

The sequence of amino acid of a protein determines protein shape , since the chemical properties of each amino acids are forces that gives rise to intermolecular interaction to begin to create secondary structure .

Amino acids are monomers of protein. So , different amino acids produce different proteins based on the bonds formed between them.

to learn more about Amino acid click here

brainly.com/question/14583479

#SPJ4

3 0
2 years ago
List four "beliefs" in which evolutionary scientists place their faith when supporting the theory of evolution. Use complete sen
VashaNatasha [74]

Answer:  Answers below.

Explanation: One aspect in which evolutionists place their faith in is the geological column. If you examine a chart of it, you will notice a trend. As you go deeper into the geological column, the fossils found there get more and more "simple". On the surface of the geological column, scientists have found more complex life forms. This trend suggests that organisms evolved over time, and the geological column represents this trend in chronological order. However, this data could be used against evolution as well. Therefore, it is inconclusive. If you believe the sedimentary rock formed so rapidly due to the biblical flood, this is evidence against evolution. If you believe rocks formed according to the observations of Charles Lyell, then this could be evidence for evolution. It all depends on how one interprets the data.

Another aspect in which evolutionists place their faith is something they call "intermediate links" Intermediate links are supposed to indicate a transitional form between two different creatures to show that they evolved. For example, evolutionists state that the creature Archaeopterynx is the transitional form between reptiles and birds. Another example of a transitional form found is the Australopithecus afarensis, which is supposed to be the transitional form between apes and humans due to similar bone structures and that this creature was bipedal like us humans.

Another belief evolutionists have to support the theory of evolution is the science of structural homology. Structural Homology is a science that studies similar structures in different organisms. For example, if you examined the forearms of a bat, bird, porpoise, and human, you would find that they have similar forearm structures, They all have a radius, humerus, ulna, carpals, metacarpals and phalanges. This indicates that all these creatures evolved from a common ancestor due to their strikingly similar structures.

Another aspect in which evolutionists place their faith is in the science of molecular biology. You see, all organisms contain a common protein called cytochrome C. Cytochrome c performs the same basic function in every organism. It is possible to calculate the percentage difference between the cytochrome c in each organism. Evolutionists have created a table that shows the percentage difference between a few different species of organisms. What they found appeared to indicate an evolutionary trend. However, more research shows that this data is highly flawed. If you calculate the percentage difference of this protein between a horse, pigeon, tuna, silkworm moth, wheat, the yeast and compared it to a bacterium ( the "simplest" life form) you would find that all these organisms are almost the same percent different from each other, indicating individual species rather than evolving from a common ancestor. All of these assumptions stated above can be evidence for or against evolution. It all is determined by how someone interprets these facts. I hope this helped you! Good luck :)

3 0
3 years ago
Fun facts about smooth Endoplasm reticulum
andreyandreev [35.5K]
<span>contain enzymes that manufacture phospholipids, steroids and fats. 
</span><span>transports substances made around cell so that it can be exported
these substances are exported by golgi bodies

</span>
8 0
2 years ago
Read 2 more answers
Yo thanks for spending time on me
Artyom0805 [142]
The answer is the septic tank or A
6 0
3 years ago
Read 2 more answers
Other questions:
  • In examining a protist, you notice that it lacks a cell wall, and has movement with cytoplasmic streaming. These data allow you
    11·1 answer
  • Name the four classes of organic compounds containing carbon
    14·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • How does Earth's gravity drive the cycling of water through Earth's systems?
    12·1 answer
  • What effect does the earths rotation have in surface currents? (Pictures)
    15·1 answer
  • Chronic fatigue syndrome results from repeated motions performed in the course of normal work and daily activities. a. True b. F
    5·1 answer
  • A population of animals feeds entirely on plants. Some of these animals are good at digesting Plant A, while others are good at
    12·2 answers
  • Which of the following statements is NOT one of the ideas Lamarck had regarding evolution ?
    14·2 answers
  • Describe what all living things must have for the next generation to be created. It is NOT
    6·1 answer
  • Precipitation is the result when the tiny condensation particles
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!