1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lawyer [7]
3 years ago
7

What occurs when a substance reacts with oxygen to form water and carbon dioxide? Explain

Biology
1 answer:
Hunter-Best [27]3 years ago
7 0

Answer:

Explanation:

a chemical reaction that occurs when a substance reacts with oxygen, releasing energy in the form of heat and light.

You might be interested in
Las semillas de las plantas, especialmente las más consumidas en nuestra dieta como el trigo, el maíz, el arroz y otros cereales
stich3 [128]

Answer:

lol I dont know the answer

3 0
3 years ago
Bagaimanakah struktur xilem dapat diadaptasikan dengan fungsinya ?​
Arte-miy333 [17]

Answer:

maledetta

Explanation:

:)

6 0
3 years ago
What are the characteristics of a multi celled organism
vlabodo [156]

Answer:

Multicellular organisms are made of more than one cell and are complex organisms.

They are visible to the naked eye.

They possess distinct organs and organ systems.

They are eukaryotes, i.e., they contain membrane-bound structures.

Their cells exhibit division of labor.

Their size increases with the number of cells in an organism

Explanation:

4 0
3 years ago
Two ways water travels from land to enter the ocean
Vesna [10]
-Water evaporates and condenses into clouds, then the clouds are blown over the ocean, and it rains.
-Water from a mountain flows down and into a river. The river empties into an ocean.
7 0
3 years ago
A research scientist writes a paper on the initial regrowth of a forest after a fire has damaged the entire ecosystem. Which tit
algol [13]
The Regrowth after Fire
7 0
3 years ago
Other questions:
  • During prophase, each pair of chromosomes is attached to each other by the _____. chromatin chromatid centromere DNA
    7·2 answers
  • What structures are found in every living cell
    10·2 answers
  • What would pass through the lumen of the esophagus?
    7·1 answer
  • Which of the following is not true concerning the layers of the earth?
    5·1 answer
  • In which stage of pertussis is the characteristic whooping sound made?
    14·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • which of the following most accurately depicts how a decline in Americas metal economy can negatively affect another countrys ec
    11·1 answer
  • Representation of system or object such as charts or maps are
    11·2 answers
  • Properties that make water unique
    13·1 answer
  • FUN QUESTION maybe challenging I'm sort stuck i can't figure out!!
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!