1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashcka [7]
4 years ago
12

BRAINLIEST BRAINLIEST

Biology
2 answers:
Furkat [3]4 years ago
5 0
B has the most mass. You can see this because it already sunk due to it being the heaviest. The block with the least mass is A, because you can see it’s sticking out of the water the most since it’s lighter, and the block with the medium amount of mass is C, since it’s partially in the water and partially underwater. Hope this helps :)
xxMikexx [17]4 years ago
3 0
B has the most mass, a has the second most and A has the least
You might be interested in
how many gender are really there? I believe that there are two male and female but people say that there are like 50
Finger [1]
Ehhhhh i think 2 but IM NOT REPUBLICAN
8 0
3 years ago
Life as we know it depends on the genetic code: a set of codons, each made up of three bases in a DNA sequence and corresponding
-BARSIC- [3]

Answer:

5 bases

Explanation:

If there are 17 amino acids and only 2 bases that can be combined in order to make a codon then:

for 4 bases 4^{2} is 16 and it is not enough combination for all 17 amino acids

for 5 bases 5^{2} is 25 combinations (meaning that more than one codon could code for the same amino acid).

3 0
3 years ago
Read 2 more answers
The pancreas and the gonads are glands with double secreation. Explain why.​
olganol [36]

Explanation:

Pancreas functions as both endocrine and exocrine gland. Hence, called as dual function gland or a mixed gland. Exocrine part of pancreas secretes digestive enzymes while, its endocrine part (islets of Langerhans) produce two hormones, i.e. insulin and glucagon.

3 0
3 years ago
For months a baby grows in a special place inside its mother called the
Iteru [2.4K]
The answer is uterus, well that's what I got
7 0
3 years ago
Read 2 more answers
Does anybody know the answers to these 2?
fgiga [73]

Ohhh I know this! Number 1 is saturated fats, Number 2 is unsaturated


8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Use the numbers 1, 2, 3, 4, and 5 to place the protein creation steps below in the correct order. Ribosome attaches to the mRNA.
    9·2 answers
  • How does an adult sponge asexually reproduce
    15·2 answers
  • What part of the plant is the apple?
    10·1 answer
  • Heat loss is defined as…
    11·1 answer
  • What are some examples of real-world applications that have improved our lives as a result of research where biology, neuroscien
    6·1 answer
  • FASTEST ONE GET BRAINLIEST!!!! make a list of 3 foods that contain carbs
    11·2 answers
  • Which of the following is NOT true about groundwater pollution?
    7·2 answers
  • Which of the following characteristics of living things could be applied to an automatic door at a supermarket?
    8·1 answer
  • List three<br>nasons<br>why<br>the demand for meat<br>for meat is increasing​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!