1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lora16 [44]
3 years ago
10

What is the charge of each particle of matter?

Biology
1 answer:
horrorfan [7]3 years ago
3 0
Well if i am reading the question right then particles of matter are either ions, protons, neutrons or electrons is this have to do with chem or physics bc the question is a little vague
You might be interested in
Which two species are most closely related?
faust18 [17]

Answer:

Two species (B & C) are more closely related to one another than either one is to a third species (A) if, and only if, they share a more recent common ancestor with one another (at Time 2) than they do with the third species (at Time 1).

Explanation:

4 0
2 years ago
What Monomer is made of base, a suger, and phosphate group?
dem82 [27]
A nucleotide is made up of a base, a sugar and a phosphate group.
8 0
3 years ago
Which of the following is the correct definition of biotechnology?
elena55 [62]

Answer: Biotechnology is the area of biology that uses living processes, organisms or systems to manufacture products or technology intended to improve the quality of human life.

Explanation:

Your welcome

5 0
2 years ago
Read 2 more answers
How many sex chromosomes does the normal human female inherit from her mother?
AveGali [126]

Answer:

A. 1.2

Explanation:

Normally, a human body cell contains 46 chromosomes - 23 inherited from the father and the same number from the mother.

Most of the human DNA, or human genes, are located in the chromosomes.

Each metaphase chromosome consists of:

two sister chromatids containing one DNA molecule each, and since they are formed by replication, these molecules are completely identical in gene content; that is why chromatids are called sister chromatids;  two centromeres, one on each chromatid.

4 0
2 years ago
What is a medical biologist
DanielleElmas [232]

Answer:

Medical biology is a field of biology that has practical applications in medicine, health care and laboratory diagnostics.

Can I get brainliest?

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which if the following genotypes is heterozygous dominant<br>A. bb<br>B. BBss<br>C. TTSS<br>D. Ss
    6·1 answer
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • Which best describe the structure of DNA?​
    13·1 answer
  • Greenhouse gases trap _____.
    6·2 answers
  • in which process does the water form clouds. A-transpiration B-condensation C-evaporation D-percolation
    8·1 answer
  • What type of survivorship curve do human beings show? Explain why we are that type?
    9·1 answer
  • 3. Which of the following statements is not part of modern cell theory? A. All living things are made up of multiple cells. B. A
    11·1 answer
  • _1. Nuclear a.energy associated with moving objects or objects that could move later
    15·1 answer
  • Drag the tiles to the correct boxes to complete the pairs.
    15·1 answer
  • A trophic pyramid for southern lake michigan coastal<br>please answer it
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!