1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreyy89
3 years ago
5

Plant and animals cells are very similar structurally, though some differences do exist. The vacuole is one organelle that diffe

rs in plant and animal cells. Which statement BEST elaborates on the reason for this difference?
A)
Vacuoles help plants make their own food by converting light energy, Animals do not make their own food.


B)
Animal cells have large vacuoles to remove waste, while plant cells do not produce waste and have small vacuoles.


C)
Vacuoles are much larger in plant cells than in animal cells, because they tend to hold more water to stay upright.


D)
Vacuoles in animal cells are porous, so oxygen can pass, while those in plant cells have solid walls to keep water inside.
Biology
2 answers:
Snezhnost [94]3 years ago
8 0
The answer is C. When a vacuole is filled with water, turgor pressure exist, it can keep the cells turgid and therfore to make the plant stay upright and prevent it from wilting.
Alexus [3.1K]3 years ago
7 0

The correct answer is; Vacuoles are much larger in plant cells than in animal cells, because they tend to hold more water to stay upright.

A vacuole is a membrane bound organelle in plants and animals cells which works by holding various solutions or molecules. The vacuoles are much larger in plant cells than in animal cells. In plant cells, the vacuole may be used to store water which help to support the plant. The solutes inside the vacuoles absorb water which makes the cells to become inflated. This allows the soft parts of the plants structure such as leaves to stay upright. Therefore, making plants to retain their shape and turgidity.


You might be interested in
The filtration membrane consists of three layers: the __________________ glomerular endothelium, the _______________ membrane, a
MariettaO [177]

Answer: the glomerular endothelium cells, the basement membrane, and the Podocyte processes...

Explanation:

The formation of urine by the kidneys occurs in 3 stages described at following:

- Glomerular Filtration - It is the 1st stage in the formation of urine. In this step large amount of liquid is filtered through the membrane from glomerular capillary to Bowman's capsule;

- Tubular Resorption - At this stage, water and some solutes are reabsorbed from the tubules into the blood;

- Tubular Secretion - In this last step occurs the secretion of substances from the blood to the tubules.

This first stage occurs in the glomerular capillaries where part of blood that reaches the glomerulus is forced to pass under pressure by a filtering barrier. This barrier is called the glomerulus filtration membrane. The glomerulus filtration membrane consists of 3 layers, two of them from the capillary (basal membrane and endothelium), and one formed by Bowman's capsule epithelial cells. The endothelial layer, as in the other capillaries, has thousands of pores called fenestrations. These pores allow the passage of all plasma except blood cells. Already the basement membrane is formed by a tangle of protein fibers that prevent the passage of larger proteins. Finally, the outermost layer is formed by the epithelial cells. Bowman's capsule protruding over the basement membrane. These cells are called podocytes since their projections resemble feet.

8 0
3 years ago
The basic unit of all life for all organisms
Jobisdone [24]

Answer:

cells

Explanation:

7 0
4 years ago
Read 2 more answers
Does the same codon always control skin color eye color and the presence of spots
Elza [17]
Yes, the same codon does always control skin colour, eye colour and the presence of spots. Each codon codes for an amino acid in the organism. ... Since the the genetic code is universal this essentially means that almost all organisms build proteins with the same genetic code
8 0
4 years ago
4. Change any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid
ruslelena [56]
Q1) 

the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.

<span>5’ agcggg  atg  agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here 
we change base A to T (capitalised)

DNA sequence with amino acids are given 
</span>5’ agcggg  atg  Tgc gca  tgt  ggc gca taa ctg 3’
N               Met Cys Ala Cys  Gly Ala stop 
after changing the base the amino acid sequence changes from Ser to Cys.

Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts 
</span>5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt  atg  cgc  cac  atg  cgc Aca tcc  cgc t 3'
              Met Arg  His Met  Arg  Thr Ser Arg
amino acid changes from Ser to Thr.

Q3) 
The sequence with amino acids before inserting a base is 
5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
We insert a base G shown in capitals 
5’ agcggg  atg  agc Ggca tgt  ggc gca taa ctg 3’

  This changes the codons of bases after the inserted base
5’ agcggg  atg  agc ggc atg  tgg  cgc ata act g 3’
                 Met  Ser Gly Met Trp Arg  Ile  Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
 to   Met  Ser Gly Met Trp Arg  Ile  Thr
                  
Q4)
the complementary strand before adding a base is 
5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
When we insert a base G, base C is added to the complementary strand 
5' cagtt  atg  cgc  cac  atg  cCgc tca tcc  cgc t 3'
this changes the codons
5' cagtt  atg  cgc  cac  atg  cCg ctc atc ccg ct 3'
              Met Arg His  Met  Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from 
Met Arg  His Met Arg  Ser Ser Arg 
to Met Arg His  Met  Pro Leu Ile Pro
7 0
3 years ago
Which force requires contact?
frozen [14]
C. Is the answer to that question
4 0
4 years ago
Other questions:
  • The simplest organisms are____.
    9·1 answer
  • Abundant and powdery pollen produced by small, indistinct flowers is probably transported by:
    10·1 answer
  • Stoping
    6·1 answer
  • Why are protists discussed in groups such as animal-like, plant-like and fungus-like protists?
    10·1 answer
  • An immature frog (a tadpole) lives in a pond or lake. However, the adult frog possesses special adaptations that permit it to su
    13·1 answer
  • PLEASSSEEE ANSWR!!! I only have 4 minutes!!!!!!
    11·1 answer
  • Two kinds of birds eat the same food and nest in the same area these two species of birds are in?​
    12·1 answer
  • What are the characteristics of northern Guinea savanna
    8·1 answer
  • Drag each tile to the correct location.
    9·1 answer
  • 11. Which organism has the lowest biotic potential?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!