1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erastovalidia [21]
3 years ago
5

Despite government protection, human activities are impacting Okefenokee. In addition to acid rain, precipitation deposits mercu

ry, emitted by coal-burning power plants and waste incinerators, to the swamp. How might this effect animal life in the swamp?
Biology
2 answers:
SCORPION-xisa [38]3 years ago
7 0

Answer:

The answer is C

Explanation:

Stels [109]3 years ago
3 0

Answer:

C) Biomagnification of mercury results in toxic levels of mercury high in the food chains.

Explanation:

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
Respiratory function deteriorates as a result of pneumonia because inflammationA) causes fluids to leak into the alveoli.B) caus
xenn [34]

The correct answer is: D) A and B only

Pneumonia is an inflammatory condition of the lungs that is usually caused by infection with viruses or bacteria. Pneumonia causes the fluid fill of the alveoli (air sacs). As a result symptoms such as cough with phlegm or pus, fever, chills, and difficulty breathing might occur. Pneumonia can be serious condition, especially for infants and people with weakened immune systems.

3 0
3 years ago
Read 2 more answers
The Mesozoic era was the “Age of Reptiles.” At the end of the Mesozoic era, many groups of animals disappeared suddenly. Scienti
Savatey [412]
A large asteroid or comet impacted the earth.
8 0
3 years ago
Please help I really need help on this question!!!
Mkey [24]

Answer:

Conduction

Explanation:

convection- not related, as it is hot air rising and cold air falling, which isn't happening.

Subduction- that has to do with the Earth's plates moving

Radiation- doesn't have to do with heated substances.

5 0
3 years ago
Give the Correct Title for the following labeled diagram
jolli1 [7]

Answer:

This is the rock cycle I believe hope this helps

4 0
3 years ago
Other questions:
  • I Need help asap please help i will give lots of points
    12·2 answers
  • You have just completed assaying the change in absorbance for an enzyme. The initial absorbance was 0.022; the absorbance after
    9·1 answer
  • Which of the following would describe Lamarck’s ideas about evolution?
    14·2 answers
  • Describe the three major sources of energy that power earth's environmental systems
    8·2 answers
  • What energy do mountainous region would be likely a source?
    14·1 answer
  • What is the uses of forest​
    5·2 answers
  • Why is the nucleus the most obvious organelle within a cell?
    7·1 answer
  • Which of the perspectives of science have you been exposed to the least?
    7·1 answer
  • What is the difference between the independent variable and the dependent variable? ( NO LINKS PLEASE)
    5·2 answers
  • Explain process of small scale cultivation of mushrooms
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!