1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zielflug [23.3K]
3 years ago
11

Newton's second law of motion explains:

Biology
2 answers:
Tatiana [17]3 years ago
8 0
It should be C)300 newtons but im like only 85% sure it is. 

Xelga [282]3 years ago
7 0
Mass × Acceleration
60 kg × 5m/^s =
300
The answer is C. 300 N
You might be interested in
The air near the center of this low-pressure system usually will
Diano4ka-milaya [45]
Naturally it will be very unstable. Likely cause bad weather or such
3 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Describe the nitrogen cycle
charle [14.2K]

Answer:

i'm in 9th grade and i'm in high school student to learn my class!

Explanation:

i like to read books, i like to bake, and i like to play my AG dolls

4 0
2 years ago
How long do mud turtle eggs take to hatch?
andriy [413]
For most turtles the incubation ranges from 45 and 75 days.
5 0
3 years ago
If you go outside on a hot summer day with a double scoop ice cream cone, how will the cold ice cream interact with the hot
sesenic [268]
Heat from the air will move into the ice cream
8 0
3 years ago
Other questions:
  • Complains of a dry mouth. the medical term for this condition is
    6·1 answer
  • B lymphocytes develop immunocompetence in the ________.
    11·1 answer
  • Answers are
    8·1 answer
  • What are two ways carbon returns from animals into the water?
    8·1 answer
  • Please help <br> What is osmosis
    6·2 answers
  • In order to save the northern spotted owl, _______ was banned on much of the old-growth forest in the Pacific Northwest where th
    8·1 answer
  • Lyme disease is a bacterial infection transmitted to humans from ticks. Which of the following approaches would be the most effe
    8·2 answers
  • which of the following types of speciation occurs when a barrier divides members of a population A) allopatric B )PARAPATRIC C)
    6·1 answer
  • A what are the events of a stars life in order
    14·1 answer
  • What is hydroponics? And what are the 2 advantages of hydroponics?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!