At which position on an electrocardiogram do the atria contract?

Biology

1 answer:

nordsb [41]2 years ago

7 0

Answer:

P wave

Explanation:

Electrocardiogram records the strength and timing of electrical activity in heart. As various regions of heart contract at different times and for different duration, the electrical activity is not constant and shows a series of rise and fall. There are three main components of ECG: P wave, QRS complex and T wave.

P wave indicates the beginning of electrical signal in the right atrium. The signal spreads in both right and left atria which leads to their contraction. As a result, blood is pumped into the ventricles and rest of the process occurs.

You might be interested in

The smooth but steady increase in muscular tension that is produced by increasing the number of active motor units is called ___

Troyanec [42]

The smooth, but steady, increase in muscular tension produced by increasing the number of active motor units is called a recruitment.

Muscle tension is the force produced when a muscle contracts (or when sarcomeres shorten). The two primary forms of skeletal muscle contractions, isotonic contractions and isometric contractions, are produced when a muscle contracts against a load that is not moving.

A load is transported as the length of the muscle varies during isotonic contractions, in which the tension in the muscle remains constant (shortens). Concentric and eccentric contractions are the two varieties of isotonic contractions.
When a muscle contracts isometrically, the angle of a skeletal joint remains the same while tension is produced in the muscle. Sarcomeres shorten and muscles tense up during isometric contractions, but the load is not moved since the force generated is insufficient to overcome the resistance provided by the load.

To know more about muscle tension click here

brainly.com/question/2794358

#SPJ4

3 0

1 year ago

The largest molecules in organisms are _____.

FromTheMoon [43]

Nucleic Acids are the largest molecule

8 0

2 years ago

Read 2 more answers

What are three differences between dna and rna?

Gelneren [198K]

DNA
1. Found in nucleus
2. Sugar is deoxyribose
3. Bases are A, T, C, and G
RNA
1. Found in nucleus and cytoplasm
2. Sugar is ribose
3. Bases are A, U, C, and G

8 0

3 years ago

Read 2 more answers

The process by which a cell divides is called

PolarNik [594]

The best answer is C

The process by which a cell divides is called mitosis. It results in two daughter cells that are genetically identical to each other and to the original cell.

Multicellular organisms, depend on mitosis for growth and repair. Organisms repair some of their tissues using mitosis to regenerate new cells. Not all cells undergo mitosis at the same rate. In man, brain cells are much more difficult to regenerate than cheek cells which are constantly being replaced.

8 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago