Answer: They create density differences that cause dense deepwater currents to flow toward the equator where they displace less dense, warmer water above them.
The temperature and salinity has a major impact on water current of oceanic water. The warm water is usually less denser than colder water, so it remains at the surface of water body, whereas the colder water being more in density remain in a depth. The salinity of cold water is more than the warm water.
According to the above explanation, they create density differences that cause dense deepwater currents to flow toward the equator where they displace less dense, warmer water above them is the correct explanation.
<span>What is the approximate age of our solar system?
</span>b. 4.6 billion years
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Nuclear reaction fission powers the both of them
