1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pychu [463]
3 years ago
15

The maximum number of orbits in an atom is _____.

Biology
2 answers:
ololo11 [35]3 years ago
3 0
The answer is 7 / good luck :)
aleksley [76]3 years ago
3 0

Correct answer is:

<h2>The maximum number of orbits in an atom is <u>Seven.</u></h2><h3>Explanation:</h3>

Every energy level has a limited one orbital including two electrons. The orbits are settled in the sub-levels and there can be further than 1 sub-level as the number of energy levels rises. On energy level 1, there is 1 sub-level and 1 orbital. Energy level 2 can possess 2 sub-levels and 2 orbitals. These remain to develop as you progress from the nucleus of the atom, closing up with an infinite potential number of levels and orbits.

You might be interested in
During a Mango season, 91 bags of mangoes were sold. Each bag contained 50 mangoes except one bag, which contained 45 mangoes. h
zmey [24]

Answer:

4545 mangoes were sold altogether lol

4 0
4 years ago
2. Describe a technique for measuring photosynthetic rate.
riadik2000 [5.3K]
Measuring photosynthesis via the production of oxygen. Oxygen can be measured by counting bubbles evolved from pondweed, or by using the Audus apparatus to measure the amount of gas evolved over a period of time.
8 0
4 years ago
Read 2 more answers
Which type of lipid is a major component of the cell membrane
Delicious77 [7]

Answer:

Phospholipids

Explanation:

Phospholipids are a particular kind of lipid (an oil) that forms a two-layered surface that surrounds and protects all living cells. The phosphates are essential to forming this bilayered structure. This membrane has a semipermeable function that selectively allows some elements and molecules to go in or out of the cell and thus helps maintain the cell in equilibrium.

3 0
3 years ago
"the force with which a solvent moves across a semipermeable membrane from a higher to a lower concentration"
Ulleksa [173]
I believe the force is called diffusion.
7 0
3 years ago
What two factors cause natural gas to form?​
harina [27]

Answer:

♡ good morning! ♡

the answer is thermogenic methane

and the combination of compression

and high temperature. have a great day! ☆

- madeline/madi

✧・゚: *✧・゚:・゚✧*:・゚✧・゚: *✧・゚:・゚✧*:・゚✧・゚

7 0
3 years ago
Other questions:
  • Which factor contributes to the formation of tides that turn turbines to create energy in the ocean?I need this Anwser ASAP!!!!!
    13·2 answers
  • What are the steps of evaporated water through the water cycle
    10·1 answer
  • An organisms Genotype can best be defined as a number of chromosome pairs a number recessive genes inherited physical appearance
    8·2 answers
  • Due to genetic mutation a deer is born with it with a missing to this makes it difficult for you to escape from
    6·1 answer
  • Pepsin, a common enzyme found in the stomach, is most active at pH values between 0.5 and 2.5. It works slowly between pH values
    5·1 answer
  • If you wanted to detect x- rays coming from the sun where would you place the detector?
    9·1 answer
  • PLEASE HELP ASAP!!
    15·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • If the mother of a child has the recessive gene for cystic fibrosis (Cc), an autosomal disorder, and the father does not (CC), w
    12·1 answer
  • The process of turning on the expression of genes in response to a substance in the environment is called:________
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!