Answer:
Graptolites lived from the Cambrian Period, about 510 million years ago, disappearing in the Carboniferous Period, around 320 million years ago.
hope this helps!
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
The question is B because the water move from the land to the air
Answer:
66.6% of the living progeny would be creepers
Explanation:
The creeper allele is Cr for both parents this means that there is a 50% chance that they will pass the C or r trait to their progeny. In this scenario the deleterious inheritance of rr will be 25% so this will not be factored in this answer. The other progeny is CC 25% and Cr 50% for genotype only
The new calculation for living progeny is this: Of the chances of three living progeny there could be one normal CC and two creepers Cr. This means that 33.3% of the living progeny is normal CC and 66.6% of the living progeny are creepers Cr.
