1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Degger [83]
3 years ago
8

Identify properties of water

Biology
1 answer:
podryga [215]3 years ago
3 0

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen.

Explanation:

You might be interested in
Which type of cell is most likely to have the most mitochondria? muscle cells in the legs of a marathon runner nondividing cells
MatroZZZ [7]

Answer:

muscle cells in the legs of a marathon runner

Explanation:

Mitochondria are the powerhouse of cells and serve as a site for the aerobic stage of cellular respiration. Cellular respiration is complete oxidation of nutrients in the presence of oxygen to produce a large number of ATP molecules. Therefore, the cells that require more ATP molecules as an energy source would most likely have a greater number of mitochondria.

Muscle cells are responsible for body movement. Muscle cells in the legs of a runner would require a constant supply of ATP during running since muscle contraction requires ATP. To sustain the continuous muscle contraction during the marathon, the muscle cells in the legs of the runner would have most number of mitochondria.  

5 0
3 years ago
If a person uses up his or her reserve supply of glycogen and still does not eat, sugar comes from the?
Anvisha [2.4K]

If a person uses up his or her reserve supply of glycogen and still does not eat, sugar comes from the muscle.

Although only liver glycogen directly contributes to the release of glucose into circulation, maintaining a healthy blood glucose concentration is one of the glycogen's key functions. Since skeletal muscles lack glucose 6-phosphatase, they are unable to release glucose, and muscle glycogen primarily serves as a local energy source for activity rather than a source of fuel to keep blood glucose levels stable while fasting.

In fact, the breakdown of muscle glycogen into lactate allows for its delivery to the liver, where it participates in the maintenance of euglycemia through the process of gluconeogenesis (Cori cycle).

To learn more about glycogen click here

brainly.com/question/13082214

#SPJ4

6 0
2 years ago
Hey can you help me with some questions​
shusha [124]

Answer: i need this answer also

Explanation:

8 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
5 ways education can affect sexual reproductive health
erastova [34]

Answer:

They teach you the purpose of condoms (or you learn the hard way.)

how to prevent stds

Explanation:

That's all I can think of.

8 0
3 years ago
Other questions:
  • Your classmate will be doing a presentation on evolutionary medicine in science class. What is he likely to discuss?
    10·1 answer
  • draw a labelled diagram of the condition of one of the vegetable cells after being immersed in the concentrated salt solution fo
    15·1 answer
  • The occurrence of a chance event during ine trail does not influence the result of later trails. this is an important principle
    12·1 answer
  • The cluster of developing cells from conception until birth is called an
    13·1 answer
  • Organs are comprised of tissues that work together to perform a specific bodily function.
    10·2 answers
  • How many crosses of red and white four-o'clock flowers would you need to find out all of the possible phenotypes fo
    15·1 answer
  • Pls help <br> a. 5 <br> b. 4 <br> c. 6 <br> d. 3<br> e. 1
    12·1 answer
  • NEED HELP ASAP PLZ
    7·1 answer
  • What is the answers to this quesition
    13·1 answer
  • The process by which ____________ become activated when the ____________ within the discs of the cells are altered by light ente
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!