1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha_Volkova [10]
2 years ago
15

Describe two social and two ethical issues of using biotechnology.

Biology
1 answer:
snow_tiger [21]2 years ago
6 0

Two ethical issues of using Biotechnology are Affordability and Privacy. Two social issues of Biotechnology are Harm to the environment and Bio-terrorism.

<u>EXPLANATION: </u>

  • The most concerning ethical issue of using biotechnology is the cost and access to new treatments.
  • The drugs that break clots that cause heart attacks, for example, are extremely expensive and so the common people cannot afford them.
  • The second ethical issue is Privacy.
  • The technology can decode the human genome which might reveal the future health information of a person.
  • The first social issue of using biotechnology is the harm to the environment.
  • It is not sure how will the ecosystem react when a new organism is introduced in the ecosystem.
  • Another social issue is that terrorists might make new superbugs or infectious viruses, using biotechnology, which might not have any cure.
You might be interested in
What is the cellular process for asexual reproduction
deff fn [24]
Mitoses and Asexual Reproduction by cell division,one cell divides to become two
7 0
3 years ago
The inflammation that tissues undergo when they become injured or irritated:​
Rashid [163]
The inflammation will not occur with tissue that is dead & has no blood supply. The injury brings a decrease in white blood cells. The Mast Cells play a role in releasing histamine which dilate capillaries and bring about hypermia cause increase blood and swelling and redness to the area
3 0
3 years ago
What is a petrified fossil
Scilla [17]

U can look up the defeniton on google

7 0
2 years ago
Read 2 more answers
What will stop if you drink too much alcohol
adell [148]

Your liver might stop. Hope this helps

4 0
3 years ago
Read 2 more answers
How many amino acids are found in nature
Firdavs [7]

Answer:

para la mayoría de los seres vivos son 20

Explanation: alanina, arginina, asparagina, aspartato, cisteína, fenilalanina, glicina, glutamato, glutamina, histidina, isoleucina, leucina, lisina, metionina, prolina, serina, tirosina, treonina, triptófano y valina.

Sin embargo, hay excepciones: en algunos seres vivos el código genético tiene pequeñas modificaciones y puede codificar otros aminoácidos

3 0
2 years ago
Other questions:
  • What 4 factors can have an effect on an areas climate?
    9·1 answer
  • A drug that blocks atp production is introduced into an isolated axon preparation. the axon is then repeatedly stimulated and re
    15·1 answer
  • When DNA is not condensed into
    5·1 answer
  • What can you learn from a set of embryo drawings of vertebrates of different phyla? A) the genotype of the species of different
    12·1 answer
  • Organic sedimentary rocks are _____. made of dissolved minerals formed from heat and pressure made from the remains of living or
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Middle adulthood extends from ages _______.
    12·1 answer
  • Which optical phenomena are formed by ice crystals?
    14·1 answer
  • ______ is a non-specific response to disease, in which the body temperature rises.
    15·2 answers
  • differences between the structure of the wall of the stomach and the structure of the wall of the ileum​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!