1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxMikexx [17]
3 years ago
11

Why do ribosomes attach to the endoplasmic reticulum

Biology
1 answer:
matrenka [14]3 years ago
6 0
The ribosomes that is synthesizing the protein is directly attached to the ER membrane
You might be interested in
A geneticist analyzes the four products of a meiosis for an Aa Bb plant and finds that two of the products have the AB alleles a
slega [8]

Answer:

No, this is not consistent with the principle of independent assortment.

Explanation:

The principle of independent assortment states that alleles from different genes assort independently. This means that if a plant has a genotype Aa Bb, all four alleles (A, a, B, and b) are going to segregate equally, so we will have the following four gametes after meiosis:

- AB

- Ab

- aB

- ab

If the researcher finds that two of the four products are AB, probably there would be a deviation of Mendel's laws.

3 0
3 years ago
Who invented bifocal eyeglasses and a clean-burning stove, and helped develop the U.S. postal system?
viva [34]

Answer:

Benjamin Franklin

Explanation:

Benjamin Franklin was one of the founding fathers of America and he is well known for his many inventions as well. All the mentioned inventions were invented by him along with his contribution towards development of U.S Postal system.

4 0
3 years ago
What is a possible advantage of genetically modified crops
mario62 [17]
<span>They can rais the number of crops produced in an amount of time, they can also reduce the need for harmful pesticides. However, they may cause more allergies in humans, producing a health risk.</span>
6 0
3 years ago
Read 2 more answers
WILL GIVE BRAINLIEST... ONLY HAVE 5 MINUTES TO ANSWER
MrRa [10]
Light waves or gravitational waves sorry if not correct
4 0
2 years ago
Read 2 more answers
In the term trace element, the adjective trace means that
Margarita [4]

Answer:

The elemental is required in very small amount. (Ans. A)

Explanation:

Trace element is also known as micro-nutrient. It is also defined as any chemical element required by living organisms in a minute or small amounts which is usually part of the vital enzyme (cells produced by catalytic protein).

Exact needs of trace elements vary among species, like commonly required plant trace elements are cooper, zinc, manganese, boron, and molybdenum. Animals commonly required iodine, manganese, and cobalt.

Absence of necessary plant trace elements required by plants in the soil causes deficiency disease, lack of animal trace elements used by animals in the soil may not harm plants, but, animals feeding on those plants develop their deficiency disease.

So, the adjective trace means that the elemental is required in a very small amount.

7 0
3 years ago
Other questions:
  • Nerve endings in the skin are located in the
    5·1 answer
  • The caregiver of an infant keeps removing the pulse oximetry sensor claiming it is too tight and hurting her baby. which respons
    15·1 answer
  • Which statement is most likely to be true of the population at point a
    9·1 answer
  • Earth is tilted 23.5° on its rotational axis. This tilt affects the amount of direct sunlight received by Earth’s hemispheres th
    9·2 answers
  • . If you were to suddenly transport to Jupiter, what would happen to your mass and weight?
    7·2 answers
  • Consider this animal cell. Which organelles are labeled G? a) centrioles b)lysosomes c)endoplasmic d)reticulum-mitochondria
    7·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • PLEASE HELP EHHHHHH );
    10·2 answers
  • What would be the most likely effect of a wildfire that burned a large area<br> of forest?
    6·1 answer
  • Which modern day organism has the most exponential eyesight in the animal kingdom?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!