1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jeka94
3 years ago
14

Sleep disorder in which a person sleeps poorly at night and can nod off suddenly at any time during the day.

Biology
1 answer:
Natali [406]3 years ago
5 0
<span>I believe the correct answer for this would be Narcolepsy. I hope this helps.</span>
You might be interested in
2. Which of the following is a CORRECT pairing of the RNA type and the
zzz [600]

ANSWER

mRNA - formed from the DNA gene sequence with the help of RNA polymerase.

EXPLANATION

mRNA contain codons which are complement to

tRNA anticodons.

rRNA formed in nucleolus.

tRNA carries the amino acid.

7 0
3 years ago
An organism that reproduces sexually has a diploid number of 30. How many
Strike441 [17]

Answer:

Gamete of organism has a haploid number of chromosomes.

2n = 30

n = 15

A diploid cell containing 30 chromosomes will result in 15 chromosomes in each of the 4 daughter cells after meiosis occurs.

After first nuclear and cellular division (Meiosis I), each daughter cell will only have 15 chromosomes as homologous chromosomes are broken apart at Anaphase I of meiosis I. Chromosomal number is halved. After the second nuclear and cellular division (Meiosis II), each daughter cell will also have 15 chromosomes. This time, instead of the chromosomal number being halved, their chromosomal contents are halved. Sister chromatids are separated at Anaphase II of Meiosis II, resulting in daughter chromosomes each.

Hope it helped!(:

Explanation:

4 0
2 years ago
The genetic makeup of an organism or its combination of alleles
Lynna [10]

Answer:

Genotype

Explanation:

7 0
3 years ago
How is an enzyme’s shape affected when it becomes denatured?
sladkih [1.3K]

Answer:

Explanation:

it becomes distorted, it can no longer bind to its substrate, it no longer works correctly. ... they each have a unique shape that the substrate needs to stick to.

8 0
3 years ago
The ____________ muscle is important in thrusting movements of the arm, much like a boxer's jab punch.
zaharov [31]
The answer would be serratus anterior.

Sentence form: The serratus anterior muscle is important in thrusting movements of the arm, much like a boxer's jab punch.
6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which statement about energy is true?
    15·1 answer
  • True or False? Kidney beans are considered to be a complete or high quality protein.
    11·1 answer
  • Mr. r married a healthy woman in his home country of italy and had three children, a boy with beta-thalassemia minor and two hea
    8·1 answer
  • What Group of a invertebrates does a butterfly belong to
    8·1 answer
  • What is the monomer of a protein? Which organelle makes proteins in a cell?
    12·1 answer
  • A tight rope walker who does not want to change his position will want the forces acting on him to be Blank Space __________. Qu
    14·2 answers
  • What are catabolic reactions
    7·2 answers
  • Different between larva and pupa of silkmoth??​
    9·1 answer
  • During the ____ phase of the menstrual cycle, the zona pellucida develops around each egg.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!