1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex
2 years ago
7

What describes the movement of water when a cell shrinks and shrivels due to osmosis

Biology
2 answers:
Natasha2012 [34]2 years ago
6 0

Answer:

plasmolysis in plant cells and haemolysis in animal cells

Explanation:

When the outside environment of a cell is hypertonic, water molecules tend to move from the cell. This is a movement from a highly concentrated area to a lowly concentrated area. The cells will shrink and shrivel. The movement of water moleculea from a high concentrated region to a low concentrated region is called osmosis.

lara [203]2 years ago
3 0

Answer:

That is called plasmolysis

You might be interested in
What counteract pressure that pushes and pulls at the side of a building during an earthquake
Evgesh-ka [11]
D. Cross braces this is the right answer
7 0
3 years ago
Which variable appears to be the control Leaf production in these plants​
My name is Ann [436]

Answer:

The correct answer is D.

Explanation:

The Temperature

Hope this helps!! ;)

Also scary story for all!!! Enjoy!!

The Haunted Forest  

Once upon a time there was a family, made up of two young ones and their parents, traveling by road to road. One day the car broke down in the forest. The parents went out to get help, and so the children would not get bored, they left them with the radio on. It turned night time and the parents still did not return. Then suddenly they heard the disturbing news go on in the radio: A very dangerous killer had escaped from a prison near the forest. Hours passed and the children's parents did not come back. Suddenly, they began to hear something really loud. ¨Bang, Bang, Bang¨. They heard that which seemed to come from something hitting the top of the car. Then, the sound became louder and louder every time. ¨BANG, BANG, BANG¨. The terrified children could no longer resist. They opened the door and ran in a hurry. Only the eldest of the children dared to turn his head to see what caused the loud noise. He should have not done it though, there was a large and scary man on top of the car, who hit the top of the vehicle with something on his hands, they were the heads of his parents! The children began to run even faster and the large man began to run towards them. The children ran into the forest and so did the large man. After that day no one ever saw those children ever again, and who knows, they may appear mysteriously next to you.

Hope you enjoyed!! ;)

4 0
2 years ago
The greatest number of individuals that an ecosystem can support within a population is the
Mashutka [201]

Answer:

Carrying Capacity

Explanation:

The definition of carrying capacity in relation to biology is, "the number of people, other living organisms, or crops that a region can support without environmental degradation."

5 0
3 years ago
What submersible craft recovered the hydrogen bomb that fell into the mediterranean sea during the palomares hydrogen bomb incid
Leya [2.2K]
A. Alvin is the correct answer.
7 0
3 years ago
Read 2 more answers
If you multiply an objects weight times its height what value do you compute?
Verdich [7]
It's the pull of gravity on an object.
Hope this helps!
7 0
2 years ago
Read 2 more answers
Other questions:
  • Sam demonstrated the formation of a type of rock. He stacked layers of cake, frosting, and jam and then squeezed the stack. The
    15·2 answers
  • What is it called when you interpret the things you observe
    6·2 answers
  • During her science fair project, Mary discovered that solutions of ionic compounds in water conduct electricity. What type of in
    7·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is the definition of hormones ​
    15·2 answers
  • Which statement correctly describes a relationship between two human body systems?
    14·2 answers
  • What is the process that leaves sediment in a new area called
    14·1 answer
  • we eat 3 slices of bread with butter and 1 cup of milk . what class of food id lacking from the diet? ​
    9·1 answer
  • If a DNA codon changes from TTA to TTC, what amino acid would the matching mRNA sequence code for?
    10·1 answer
  • Exposure to pesticides or industrial chemicals _______. a. always has immediate and apparent side effects b. decreases the risk
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!