1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MArishka [77]
3 years ago
15

What is the effect of the following changes on the O2 affinity of hemoglobin?

Biology
1 answer:
Vladimir79 [104]3 years ago
3 0

Answer and Explanation:

The affinity of hemoglobin for Oxygen is controlled when the ligands H^{+} , CO_{2} and BPG binded.

The binding of every ligand moves the saturation curve of  Oxygen towards right—that is, the oxygen affinity of hemoglobin is decreased within the sight of ligand.  

(a) A pH drop will expand the oxygen affinity to myoglobin and decline the oxygen affinity for hemoglobin. This implies less oxygen will be taken by the lungs and more will be off stacked at the tissues diminishes the affinity.

(b) An abatement in the partial pressure of CO_{2} will expand affinity of oxygen to hemoglobin and diminishes the affinity of oxygen for myoglobin expands the affinity.

(c) An expansion in BPG levels diminishes the affinity of oxygen for hemoglobin and expands oxygen's affinity for myoglobin  diminishes the affinity.  

(d) As CO ties to a couple of subunits of a hemoglobin tetramer, the affinity for oxygen is expanded generously in the rest of the subunits. Subsequently, a hemoglobin tetramer with two bound CO particles can productively tie oxygen in the lungs—yet it discharges almost no of it in the tissues.

You might be interested in
ILL GIVE BRAINLIEST!!!
Semenov [28]

Answer:

in my opinion i think its B because it makes more sence.

3 0
2 years ago
Read 2 more answers
*PLEASE ANSWER* How can someone live smarter to reduce his/her carbon footprint? a.) live in a smart community b.) buy inefficie
Ymorist [56]

Answer:

a.) live in a smart community

Explanation:

A standard incandescent light burns through 50 watts of electricity per hour. Replacing an incandescent bulb with an LED bulb can save 6 tons of household emissions per year. Saving 6 tons of carbon emissions is the same as reducing your gas consumption by 700 gallons. (proving b wrong)

you can help reduce your carbon footprint and other greenhouse gases by using energy-efficient home appliances since they have lower emissions of harmful gases into the environment. (proving c wrong)

5 0
3 years ago
Read 2 more answers
List and briefly describe in your own words the four main points of Darwins theory.
patriot [66]

Answer:

Individuals of a species are not identical, Traits are passed from generation to generation, more offspring are born that can survive,and only the surviovrs of the competition for resources will reproduce.

Explanation:

7 0
3 years ago
What happens when ATP is converted to ADP
Kaylis [27]

The electrons in these bonds carry energy. Within the power plants of the cell (mitochondria), energy is used to add one molecule of inorganic phosphate (P) to a molecule of adenosine diphosphate (ADP). The amount of energy stored is about 7,300 calories for every mole of ATP formed.


6 0
2 years ago
What differs among DNA structures of different species?
weqwewe [10]

Answer:

D) the arrangement of the nucleotides within genes

Explanation:

De-oxy ribo nucleic acid that is basically a polymer of nucleotides. Nucleotides are composed of three basic units: a de-oxyribose sugar unit, a phosphate group and nitrogenous bases that can be Adenine, Gunanine, Thymine and Cytosine.Adenine always pairs with Thymine and Guanine always pairs with Cytosine.

This is a universal composition of DNA in each and every living organism. The genes are a segment of DNA that contain specific sequence of nucleotides and encode for a specific trait of organism such as height, weight, eye color etc. The sequence of nucleotides expresses the trait in the form of protein product during the process of Translation. The products of translation are amino acids and every amino acids encode for a specific protein  in almost  all living organisms.

So, what differs in the specie is the sequence of nucleotides in genes. Infact this is the nucleotide sequence which brings evolution in organism and organisms evolve to form new specie with the passage of time. One major cause of change in nucleotide sequence is mutations due to which the organisms change with time.

Suppose the sequence of nucleotide of specific gene in organism A is

AAGGGGAAATTT

However in other specie organism B of same specie is:

TAGGGGAAATTT

This means only mutation of one base changed the gene in organism B and also its product called protein.

Hope it help!

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following statements is true?
    5·2 answers
  • Homer had a low birth weight because his mother did not to eat sufficient amounts of calories during his development during gest
    7·1 answer
  • A species of protozoan-carrying mosquito lives in a meadow. The protozoan, if transmitted to mammal hosts through a bit, can be
    7·2 answers
  • Identify 2 things that can cause mutations
    7·1 answer
  • A mutation leads to a single base-pair insertion in an orf. how would this mutation be classified
    9·1 answer
  • Ultraviolet light causes production of vitamin d3 in the cells of the __________. ultraviolet light causes production of vitamin
    14·1 answer
  • When is cytokinesis complete?
    6·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • To which of the following environmental changes are populations most able to adapt?
    11·2 answers
  • 1. What do epidemiologists study?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!