1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RSB [31]
3 years ago
9

cells have a variety of organelles each with a specific function the organelles must work together in order for the cell to surv

ive.
Biology
1 answer:
Alona [7]3 years ago
6 0

Answer:

<u>Chloroplast</u>

The chloroplast is where photosynthesis occurs in plant cells. During photosynthesis, sunlight energy, carbon dioxide, and water are converted into simple sugars (glucose). These simple sugars are cell's version of food.

<u>Mitochondria</u>

The mitochondria is where cellular respiration occurs. During the process of cellular respiration, glucose, which is produced through photosynthesis in the chloroplasts, is broken down into cellular energy that can be used by the cell.

- Both chloroplasts and mitochondria are organelles that generate metabolic energy.

~Hope this Helps!~

You might be interested in
Suppose that a dominant allele (P) codes for a polka-dot tail and a recessive allele (p) codes for a solid colored tail. If two
stepan [7]
The answer is A. When doing crosses with Punnett squares, two heterozygous individuals will produce one dominant, two heterozygous, and one recessive. The genotypic ratio would be 25% PP 50% Pp and 25% pp. The phenotypic ratio would be 75% polka-dot tail and 25% solid-colored tail. Since Pp has a dominant in it, it overshadows the recessive so 25% and 50% added would be 75%.
7 0
3 years ago
Which cell process occurs only in organisms that reproduce sexually
Levart [38]

Answer:

MEIOSIS is that cell process that only occurs in organisms that reproduce sexually.

Explanation:

Eukaryotic organisms are the type of organisms that have have  nucleus and other membrane bound organelles. In complex eukaryotic organisms, sexual reproduction takes place. Through the process of meiosis, the production of gamete or reproductive cells i.e the sperm or egg takes place.

Meiosis produces four daughter cell from a single parent cell. each of the daughter cell is haploid. haploid means containing half the number of the chromosomes as the original parent cell.

7 0
3 years ago
How can we easily determine VEGF V E G F expression in a western blot experiment?
asambeis [7]

Answer: By using a primary antibody targeting VEGF.

Explanation:

6 0
2 years ago
Need help emt science class
Sophie [7]

Answer:

What to do during a flood

Explanation:

7 0
3 years ago
In a Venn diagram, the separate circles contain characteristics unique to each item being compared and the intersections contain
Inessa05 [86]

Answer:

   Correct

Explanation:

When combining more than two circles in a Venn diagram you have to actually mix in the colors where the intersections are so that you will be able to tell their differences.

7 0
3 years ago
Read 2 more answers
Other questions:
  • An unresponsive state from which a person can be aroused only briefly despite vigorous, repeated attempts is known as a _______.
    7·1 answer
  • The lipid bilayer molecules do what for the cell? A. help cells recognize each other B. allow food molecules into the cell C. pr
    6·2 answers
  • Which best shows how louis pasteur's discovery of gems improved health in general?
    8·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What is the meaning of friction​
    6·1 answer
  • TRUE OR FALSE evaporation occurs when water falls from clouds
    12·1 answer
  • Which of the following terms is used to describe cells that lack a nucleus?
    15·1 answer
  • Which characteristic is least likely to apply to a fat-soluble vitamin?
    9·1 answer
  • Amkphgnezr​<br>join join​
    9·2 answers
  • g What is the first step of the scientific method? a. Observe a phenomenon. b. Design and conduct an experiment. c. Formulate a
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!