1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AVprozaik [17]
3 years ago
13

Asexual reproduction

Biology
1 answer:
attashe74 [19]3 years ago
8 0
That statement is not correct for asexual reproduction.

Asexual reproduction is when an organism produces offspring that inherit the same genes of the producer (it's essentially, a copy of itself).

It´s a type of reproduction practiced by Achaea and bacteria which are single-celled organisms.

You might be interested in
Can someone please tell me what bug this is?
viva [34]

Answer:

kinda looks like a cricket or grasshopper prob a cricket tho

Explanation:

5 0
3 years ago
I need an answer for this ASAP!!
NISA [10]

Answer:

the answer is the second one

6 0
2 years ago
How does an impulse move during reflex arc? *
TiliK225 [7]

Answer:

Reflex arcs

Sensory neuron sends electrical impulses to a relay neuron, which is located in the spinal cord of the CNS. Relay neurons connect sensory neurons to motor neurons. Motor neuron sends electrical impulses to an effector. Effector produces a response (muscle contracts to move hand away).

4 0
3 years ago
Evaluate and discuss the importance of maintaining biodiversity for future medical needs
vivado [14]
Biodiversity is essential in medicine as most active chemicals used to make medicines are derived from plants or other organisms. Climate change today threatens species that are vital to medicine. An example would be coral reefs. Studies have been done on reefs that look at fighting cancers, HIV and other ailments. One of the richest zones of biodiversity is the tropics and this region is under threat from global warming and deforestation. It is important to preserve these species for use in future medicinal research. <span />
6 0
3 years ago
In some coastal areas, the air temperature is high throughout the day. There is often precipitation in the late afternoon. Which
kondor19780726 [428]
B. Rain hope I helped
5 0
3 years ago
Other questions:
  • Be-19 what must a type iii marine sanitation device have when boating on inland waters?
    6·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of these statements is completely true about the WT situation above?
    6·1 answer
  • T/F<br> During light-independent reactions, ATP and NADPH molecules are formed.
    9·2 answers
  • which season is occuring in Earth's northern hemisphere when Earth's southern hemisphere is tilted toward the sun?
    11·1 answer
  • Choose the right answer from the given question.
    15·1 answer
  • Any object struck at its natural frequency will vibrate violently. This is known as resonance. Applications of this include eart
    10·1 answer
  • What does the ocular lens do in the compound microscope
    11·2 answers
  • How does the excretory system work with the muscular system?
    15·1 answer
  • Which process during meiosis allows for genetic differences in gametes?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!