1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis-greek [22]
3 years ago
5

In sexual reproduction, offspring inherit twice the DNA of each parent. _

Biology
2 answers:
Oduvanchick [21]3 years ago
5 0
Answer :

False

Explanation
nata0808 [166]3 years ago
3 0

Answer:

False!

Explanation:

You might be interested in
How does a mask protect us?
nata0808 [166]

Answer:

Masks are a simple barrier to help prevent your respiratory droplets from reaching others. Studies show that masks reduce the spray of droplets when worn over the nose and mouth.

Explanation:

5 0
2 years ago
_______ are filtering points throughout the body which act to filter bacteria and other large particles from the spaces between
Maurinko [17]
D. Lymph nodes are the filtering points throughout the body... found in the lymphatic system
4 0
3 years ago
Bay Lake is having an algal bloom. Algal blooms occur when algae grow quickly because of extra nutrients in the water.
mina [271]
D I think would be the answer
7 0
2 years ago
Contrast the effects of harmful and helpful mutations.<br>HELP
juin [17]

Answer:

The majority of mutations are neutral in their effects on the organisms in which they occur. Beneficial mutations may become more common through natural selection. Harmful mutations may cause genetic disorders or cancer.

Explanation:

4 0
2 years ago
Read 2 more answers
Where are coral reefs most threatened by pollution, and what effects has pollution had so far?
NeTakaya

Answer:

In the great barrier reef

Explanation:

It has effected plants and sea creature populations because of their homes being destroyed

7 0
2 years ago
Other questions:
  • NEED ASAP !!!!!
    5·2 answers
  • Why were physical activity and caffeine and alcohol intake the controlled variables?
    6·1 answer
  • How does an adult sponge asexually reproduce
    15·2 answers
  • PLEASE HELLPPP! Will mark brainliest
    11·1 answer
  • Most of the water vapor in earths atmosphere comes from
    5·1 answer
  • Match the following items. 1. equilibrium temperature 2. caused by collisions with container walls evaporation = condensation 3.
    6·1 answer
  • What’s a example of extrusive rock that cooled to quickly for grains to form
    11·1 answer
  • What observation supports the claim that earth rotates
    6·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Which part of the large intestine helps fight parasites that have survived the previous digestive tract?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!