1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
earnstyle [38]
3 years ago
10

Which is the main reason cells are replaced in the body?

Biology
1 answer:
alisha [4.7K]3 years ago
5 0
Calls Can Get Damaged, OR Age And Die. We Wouldn't Be "Us" If We Didn't Have Cells. Hope That Helps
You might be interested in
Some animals shiver as a natural, involuntary response to their environment. Shivering generates heat. This is an example of whi
anyanavicka [17]

Answer: The answer is C!!! :D maintaining homeostasis by regulating the body's temp!

Explanation:

Shivering as a natural, involuntary response to generate heat is an example of  maintaining homeostasis by regulating body temperature.

Homeostasis refers to the maintenance of a relatively constant body environment. The normal range of operation of the body system is known as the setpoint.

When the setpoint temperature for some animals is breached, a negative feedback mechanism is used to return it to the setpoint. Shivering to generate heat is a response to a cold environment when the body's temperature is about to drop below the setpoint.

The oppositeis sweating. Sweating causes cooling and comes in response to when the setpoint temperature is exceeded.

Hopes this helps happy early Christmas!!!! :D

8 0
2 years ago
Read 2 more answers
A dominant allele masks/hides the effect of a recessive allele.
valkas [14]

Answer: True

Explanation: If you have a dominant allele it will show in the phenotype of the organism. To show a recessive allele you need a recessive pair consisting of only recessive alleles

Hope this helps

5 0
2 years ago
What is the promoter?
VLD [36.1K]
People who advertises items or things to put there ideas out there.
3 0
3 years ago
Read 2 more answers
Which of These is a exoskeleton<br><br> A. Deer<br><br> B. crab<br><br> C. tree<br><br> D. elephant
Bogdan [553]
B. Crab

is your answer

An crab has an exoskeleton

hope this helps
7 0
3 years ago
¿Todas las venas conducen sangre pobre en oxigeno?
Amanda [17]

Answer:

El aparato circulatorio unidireccional transporta sangre a todas las partes del cuerpo. Este movimiento de la sangre dentro del cuerpo se denomina «circulación». Las arterias transportan sangre rica en oxígeno del corazón y las venas transportan sangre pobre en oxígeno al corazón.

Explanation:

4 0
2 years ago
Other questions:
  • Assuming the carbon cycle is a closed system, which of the following statements is true?
    11·2 answers
  • Help!! i can’t fail this class
    9·1 answer
  • What type of ecological interaction exists between the koala and the eucalyptus?​
    10·1 answer
  • An abiotic factor affecting the behavior and survival of birds is the
    14·2 answers
  • Dylan has two cubes of iron. The larger cube has twice the mass of the smaller cube. He measures the smaller cube. Its mass is 2
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which one of the following molecules is a byproduct of cellular respiration? A. Water B. Pyruvate C. Glucose D. Oxygen
    9·1 answer
  • 1). Describe how a predator, a prey, and a scavenger differ from each other. Give an example of each.
    10·2 answers
  • Mrs. Smith has blood type A. Mr. Smith has blood type B. Their first child has blood type AB. Their second child has blood type
    10·1 answer
  • I need help with this practice Give a general description of Kudzu If you do not know some info that’s fine :)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!