1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Whitepunk [10]
3 years ago
5

What features of life are suggestive of a common origin?

Biology
1 answer:
AlladinOne [14]3 years ago
8 0
The universal genetic code known as DNA, found in all living organisms, is firm indication of a common design of all life. The actual number of first organisms is not known, making the prospect of common origin not only singular, as God, the creator of life, initially created the first life to bioform the Earth, changing the surface, the seas, and the atmosphere to prepare the environment for the progression of more complex life that would follow.

DNA is the most complex information system in the universe, firmly establishing the existence of God, the creator, as no naturalistic process could ever create life.
You might be interested in
Helppppp plsssssssss
DochEvi [55]
The first one is hyperbole.
6 0
3 years ago
Read 2 more answers
Pleas give me an answer if you actually really know the answer because everybody is giving different answers, pls
Butoxors [25]

Answer:

plants

Explanation:

plants are green

3 0
3 years ago
Read 2 more answers
The disease diabetes mellitus is due to either destruction of the cells that produce insulin or a decrease in sensitivity of tar
jenyasd209 [6]

Explanation:

Diabetes mellitus results from a deficiency in the amount of insulin released from the pancreas in response to glucose (type I) or from a decrease in the ability of muscle and fat cells to respond to insulin (type II). In both types, the regulation of blood glucose is impaired, leading to persistent hyperglycemia and numerous other possible complications in untreated patients such as tissue damage, raises the risk of heart-attack, kidney disease and vision deterioration. Type I diabetes is caused by an autoimmune process that destroys the insulin-producing B cells in the pancreas. Also called insulin-dependent diabetes, this form of the disease is generally responsive to insulin therapy. Most Americans with diabetes mellitus have type II, but the underlying cause of this form of the disease is not well understood.

4 0
3 years ago
Approximately 2 million years ago the genus Australopithecus gave rise to a new genus, Homo. Today, we retain the genus as Homo
nydimaria [60]
There was two of the same question, but here is the answer again with a little more depth.

D - spine alignment and foot size.

It was only the late Australopiths that had an S-shaped spine. This allowed for them to be bipedal, that is, the ability to walk on two legs as we do. This is because the S-shaped spine allowed them to balance when they were standing. The late Australopiths also have shorter and less flexible toes. These smaller, but sturdier feet made pushing off the ground much easier - aiding in their bipedalism. 
7 0
3 years ago
Read 2 more answers
Explain why infectious otitis media may result in a simultaneous pharyngitis.
olga_2 [115]

The ear cavity (which is affected in infectious otitis) is connected by a duct (the Eustachian tube) to the nasopharynx located behind the nasal fossae.

Otitis is related to a bacterial or viral infection, which most often contaminating the middle ear as a result of rhino-sinusitis or rhino-pharyngitis by borrowing the Eustachian tube or vice versa (otitis media evolving towards a pharyngitis).

5 0
3 years ago
Other questions:
  • 1. What are cell cycle regulators?
    13·1 answer
  • What drives the ATP synthase reactions that produce ATP?
    7·1 answer
  • Which pair of statements best describes an essential amino acid?
    10·2 answers
  • What is the name of the glass container above that you used to heat water
    15·2 answers
  • Which level of organization is directly below organ system? organelle cell tissue organ
    5·2 answers
  • A group of cells is assayed for DNA content immediately following mitosis and is found to have an average of 4 picograms of DNA
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The hormone that helps male gametes mature is
    8·1 answer
  • Illustrate the different stages of Menstrual Cycle.​
    9·1 answer
  • Which field studies viruses and bacteria and
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!