Answer:
2Major Structures and Functions of the Brain
Publication Details
Outside the specialized world of neuroanatomy and for most of the uses of daily life, the brain is more or less an abstract entity. We do not experience our brain as an assembly of physical structures (nor would we wish to, perhaps); if we envision it at all, we are likely to see it as a large, rounded walnut, grayish in color.
This schematic image refers mainly to the cerebral cortex, the outermost layer that overlies most of the other brain structures like a fantastically wrinkled tissue wrapped around an orange. The preponderance of the cerebral cortex (which, with its supporting structures, makes up approximately 80 percent of the brain's total volume) is actually a recent development in the course of evolution. The cortex contains the physical structures responsible for most of what we call ''brainwork": cognition, mental imagery, the highly sophisticated processing of visual information, and the ability to produce and understand language. But underneath this layer reside many other specialized structures that are essential for movement, consciousness, sexuality, the action of our five senses, and more—all equally valuable to human existence. Indeed, in strictly biological terms, these structures can claim priority over the cerebral cortex. In the growth of the individual embryo, as well as in evolutionary history, the brain develops roughly from the base of the skull up and out ward. The human brain actually has its beginnings, in the four-week-old embryo, as a simple series of bulges at one end of the neural tube.
sana makatulong❤️
During inter-phase of cell division, the genetic material is duplicated to allow for division into 2 identical daughter cells. The tumour suppressor gene checks for errors in the DNA, and if found, apoptosis (cell death) is initiated by p53 protein. The pRb (retinoblastoma) protein stops the progression of the cell cycle form G0 into S phase if the cell division is complete hence stemming unregulated cell division.
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
Double fertilization happens when one sperm cell wires with the egg to create a zygote, and the other sperm cell wires with the two polar cores to make the endosperm.
To answer the above:
Once double fertilization occurs in plants, the zygote is diploid and the endosperm is <span>triploid.</span>