1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrei [34K]
3 years ago
10

A biology student is hiking through a field when she notices a plant that has long, slender leaves with parallel veins. Which is

most likely also true about this plant?
A. it will have vascular bundles arranged in rings in its stem

B. it will not produce fruit

C. it will have petals in groups of five

D. it will have one seed leaf in its seeds
Biology
2 answers:
liubo4ka [24]3 years ago
6 0
The answer is C. 

I have seen a flower that had its veins going parallel. But the flower I saw had thick leaves. It was a big flower to be honest. Besides that the flower had flowers growing all around it in the pot and I think it was due to some leave petals falling to the dirt and just making more plants.


meriva3 years ago
3 0
Hey there,

<span>A biology student is hiking through a field when she notices a plant that has long, slender leaves with parallel veins. Which is most likely also true about this plant?

Your correct answer would be </span>\boxed{ it \ will \ have \ petals \ in \ groups \ of \ five} based on my research.

It's a trait that has only one seed which leads to a having a bundle on many pedals.

Hope this helps.

~Jurgen
You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Which of the following distinguishes why large corporate farms are losing favor with the public? pleas help me out!
polet [3.4K]
The public is upset with the farms’ unnatural farming practices.
7 0
3 years ago
Read 2 more answers
Please help me on this thank you so much
Ipatiy [6.2K]
During a lunar eclipse, the Earth gets in between the sun and the moon
5 0
3 years ago
Read 2 more answers
Fill in the blank.
pychu [463]

Answer:

1. The offspring will be all tall pea plants

2. 3:1 is the ratio for tall and short

6 0
3 years ago
What portion of the nervous system controls digestion?
agasfer [191]

Answer: Peripheral System

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • *PLEASE HELP*
    15·1 answer
  • Environments are covered with manmade structures like roads, buildings, and sewers. Green spaces such as parks, backyards, and u
    9·2 answers
  • Which of the listed relationships between groups is correct?
    12·1 answer
  • Which of the following are found in both DNA an RNA
    13·1 answer
  • PLEASE HELP John had a science fair project that he needed to do. He wanted to test the effects that organic and chemical fertil
    12·1 answer
  • Neurons are classified functionally according to the direction the action potential travels relative to the ____________ . Affer
    6·1 answer
  • Write difference between breathing and sespisation​
    9·1 answer
  • Fungi are made up of _______ cell(s).
    13·2 answers
  • What happens if I recycle my plastic consumption for a week?
    14·1 answer
  • Does green algae to water flea move from primary consumer to secondary consumer
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!