1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olin [163]
3 years ago
9

In activating cytokine receptors, a: Please choose the correct answer from the following choices, and then select the submit ans

wer button. Answer choices cytokine dimer interacts reversibly with a receptor homodimer. cytokine monomer interacts reversibly with a receptor homodimer. cytokine dimer interacts reversibly with a receptor heterodimer. cytokine monomer interacts reversibly with a receptor heterodimer. None of the answers is correct.
Biology
1 answer:
katrin2010 [14]3 years ago
3 0

Answer:

ewan ko hahahah ano ba dapat sagot comment kayo hahahha

You might be interested in
Which of the following is not a common teratogen? a. HIV infection b. SSRI antidepressant medications c. Folic acid d. Alcohol
poizon [28]

Option C

Folic acid  is not a common teratogen

<u>Explanation:</u>

Teratogen -  Any factor that can interrupt the growth of a fetus or embryo. Teratogens may generate a birth deformity in the child. Or a teratogen may terminate the pregnancy unmitigated. The aspects of teratogens include radiation, parental infections, drugs.

Alcohol exploitation can produce mental obstacles, distortion, germination obstacles, miscarriage, and behavioral complications in newborns. Women who have not taken the hepatitis B vaccine should be held for immunization if they are at danger of sexually dispatched disease or blood appearance. The vaccine may be administered during pregnancy. SSRI antidepressant medications is also a factor of teratogen to cause deformity to fetus growth.

6 0
3 years ago
During cellular respiration water is produced as a by product. Based on this description, we should classify cellular respiratio
Svetach [21]

Answer:

A) dehydration

Explanation:

6 0
3 years ago
Read 2 more answers
Why are ecosystems with grass better for herbivores than ecosystems with<br> trees?
White raven [17]

Why are ecosystems with grass better for herbivores than ecosystems with trees?

Trees cannot store a lot of energy in the leaves, so grass would be better.

8 0
3 years ago
Read 2 more answers
When performing a biceps curl, tension in the biceps brachii muscle increases. Which of the following structures detects and res
mars1129 [50]

Answer:

A) Golgi tendon organ.

Explanation:

A tendon organ or neurotendinous organ or Golgi tendon organ is a mechanoreceptor located at the insertion point of the skeletal muscle to the tendon that is at the myotendinous junction.

The Golgi tendon organ is composed of the collagenous muscle fibres which contain the receptors which sense the contraction of active stretch of the muscles and sends it to the brain. The brain sends the response and the muscle act by the inverse myotatic reflex.

Thus, Option-A is the correct answer.

7 0
4 years ago
Read 2 more answers
Which scenario would require the largest use of natural resources?
Vesnalui [34]
I think the answer would be number 1: - Building stone structures for housing.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Btx depolarizes the membrane and prevents repolarization. what effect would this have on electrical signaling by the nervous sys
    10·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • 7. During osmosis A) Pure solvent diffuses through a membrane, but solutes do not. B) Pure solutes diffuse through a membrane, b
    12·1 answer
  • Pleaaseee heeelp <br>explain the origin of the universe precedes the origin of life
    11·2 answers
  • Autotrophs are found at the _____ of a food pyramid.
    11·2 answers
  • Nasim is driving on a snow-covered road, and her car begins to slide. The quick behavioral response and the increased heart rate
    7·1 answer
  • Why are invasive species problem for the ecosystem
    14·1 answer
  • What's the answer pleaseeeeeeee
    6·2 answers
  • How is biodiversity a measure of health?? some one please help me
    14·1 answer
  • This center part is not present in everyone's hair or may be broken into segments.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!