Question

4. Change any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid

Answer 1

Q1) 

the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.

5’ agcggg  atg  agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here 
we change base A to T (capitalised)

DNA sequence with amino acids are given 
5’ agcggg  atg  Tgc gca  tgt  ggc gca taa ctg 3’
N               Met Cys Ala Cys  Gly Ala stop 
after changing the base the amino acid sequence changes from Ser to Cys.

Q2)
the complementary strand of the above strand is as follows 
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts 
5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt  atg  cgc  cac  atg  cgc Aca tcc  cgc t 3'
              Met Arg  His Met  Arg  Thr Ser Arg
amino acid changes from Ser to Thr.

Q3) 
The sequence with amino acids before inserting a base is 
5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
We insert a base G shown in capitals 
5’ agcggg  atg  agc Ggca tgt  ggc gca taa ctg 3’

  This changes the codons of bases after the inserted base
5’ agcggg  atg  agc ggc atg  tgg  cgc ata act g 3’
                 Met  Ser Gly Met Trp Arg  Ile  Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
 to   Met  Ser Gly Met Trp Arg  Ile  Thr
                  
Q4)
the complementary strand before adding a base is 
5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
When we insert a base G, base C is added to the complementary strand 
5' cagtt  atg  cgc  cac  atg  cCgc tca tcc  cgc t 3'
this changes the codons
5' cagtt  atg  cgc  cac  atg  cCg ctc atc ccg ct 3'
              Met Arg His  Met  Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from 
Met Arg  His Met Arg  Ser Ser Arg 
to Met Arg His  Met  Pro Leu Ile Pro