1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kogti [31]
3 years ago
11

4. Change any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid

Biology
1 answer:
ruslelena [56]3 years ago
7 0
Q1) 

the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.

<span>5’ agcggg  atg  agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here 
we change base A to T (capitalised)

DNA sequence with amino acids are given 
</span>5’ agcggg  atg  Tgc gca  tgt  ggc gca taa ctg 3’
N               Met Cys Ala Cys  Gly Ala stop 
after changing the base the amino acid sequence changes from Ser to Cys.

Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts 
</span>5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt  atg  cgc  cac  atg  cgc Aca tcc  cgc t 3'
              Met Arg  His Met  Arg  Thr Ser Arg
amino acid changes from Ser to Thr.

Q3) 
The sequence with amino acids before inserting a base is 
5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
We insert a base G shown in capitals 
5’ agcggg  atg  agc Ggca tgt  ggc gca taa ctg 3’

  This changes the codons of bases after the inserted base
5’ agcggg  atg  agc ggc atg  tgg  cgc ata act g 3’
                 Met  Ser Gly Met Trp Arg  Ile  Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
 to   Met  Ser Gly Met Trp Arg  Ile  Thr
                  
Q4)
the complementary strand before adding a base is 
5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
When we insert a base G, base C is added to the complementary strand 
5' cagtt  atg  cgc  cac  atg  cCgc tca tcc  cgc t 3'
this changes the codons
5' cagtt  atg  cgc  cac  atg  cCg ctc atc ccg ct 3'
              Met Arg His  Met  Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from 
Met Arg  His Met Arg  Ser Ser Arg 
to Met Arg His  Met  Pro Leu Ile Pro
You might be interested in
Cell division allows ALL multicellular organisms to do what? A. develop B. reproduce C. eliminate waste D. produce energy
LuckyWell [14K]
When cells divide they aren't producing energy. they produce energy through cellular respiration ( animal cells) and cellular respiration and photosynthesis ( plant cells)
cell division helps organisms develop (A)
3 0
4 years ago
What is the cure of this pandemic<br>​
natta225 [31]

Answer:

people

Explanation:

wearing masks, sraying at home,

8 0
3 years ago
Read 2 more answers
What enzyme is responsible for a copy of rna made from dna?
sertanlavr [38]

Answer:

The correct answer is RNA polymerase.

Explanation:

The process of making RNA from DNA is called transcription and the most important and primary enzyme that helps in converting DNA into RNA is called RNA polymerase.

RNA polymerase uses only a single strand of DNA which is called template strand for the formation of mRNA. RNA polymerase synthesizes RNA strand in 5' to 3' direction because it adds the new nucleotide at the 3' end of the building strand.

After formation of mRNA translation process occurs in which the nucleotide sequence in the mRNA is expressed in the form of protein.

4 0
4 years ago
What is a condition in which nerves are entrapped between the metatarsal heads producing swelling with distal, radiating pain?
Mumz [18]
The correct answer is Morton's Neuroma.
This is a condition which affects the nerves between your toes, and causes you to feel as if you were 'walking on a marble.' You feel constant pain in the ball of your foot which can be helped relatively easy if you change your footwear. 
8 0
3 years ago
Which of the following best describes how most scientists think humans evolved?
emmainna [20.7K]

Answer:

the answer is a

Explanation:

3 0
4 years ago
Read 2 more answers
Other questions:
  • Why was Mendel's experiment not common for nineteenth century scientist
    15·1 answer
  • All of the following are considered classification groups of viruses except
    15·2 answers
  • Once the _____ is synthesized, it leaves and enters the______.
    10·2 answers
  • A scientist discovered a microscope, unicellular organism with no nucleus. Which of the following correctly describes the organi
    7·2 answers
  • Upon entering the​ bloodstream, heroin is almost immediately metabolized​ into
    5·1 answer
  • What two digestive processes occur in the small intestine
    12·1 answer
  • Cutting the dna into fragments
    13·2 answers
  • Which process increases the salinity of ocean water?
    15·1 answer
  • If Alex abducts her arm completely, which action could she have taken?
    10·1 answer
  • Which answer gives both a positive impact and a negative impact associated with the effects of nitrogen- and phosphorus-enhanced
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!