1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kogti [31]
3 years ago
11

4. Change any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid

Biology
1 answer:
ruslelena [56]3 years ago
7 0
Q1) 

the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.

<span>5’ agcggg  atg  agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here 
we change base A to T (capitalised)

DNA sequence with amino acids are given 
</span>5’ agcggg  atg  Tgc gca  tgt  ggc gca taa ctg 3’
N               Met Cys Ala Cys  Gly Ala stop 
after changing the base the amino acid sequence changes from Ser to Cys.

Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts 
</span>5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt  atg  cgc  cac  atg  cgc Aca tcc  cgc t 3'
              Met Arg  His Met  Arg  Thr Ser Arg
amino acid changes from Ser to Thr.

Q3) 
The sequence with amino acids before inserting a base is 
5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
We insert a base G shown in capitals 
5’ agcggg  atg  agc Ggca tgt  ggc gca taa ctg 3’

  This changes the codons of bases after the inserted base
5’ agcggg  atg  agc ggc atg  tgg  cgc ata act g 3’
                 Met  Ser Gly Met Trp Arg  Ile  Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
 to   Met  Ser Gly Met Trp Arg  Ile  Thr
                  
Q4)
the complementary strand before adding a base is 
5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
When we insert a base G, base C is added to the complementary strand 
5' cagtt  atg  cgc  cac  atg  cCgc tca tcc  cgc t 3'
this changes the codons
5' cagtt  atg  cgc  cac  atg  cCg ctc atc ccg ct 3'
              Met Arg His  Met  Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from 
Met Arg  His Met Arg  Ser Ser Arg 
to Met Arg His  Met  Pro Leu Ile Pro
You might be interested in
What is the energy conversion that takes place during photosynthesis?
Juli2301 [7.4K]

Answer:

potential energy to kinetic energy

3 0
3 years ago
Read 2 more answers
State the effect of genetic bottlenecks
Wittaler [7]

Answer:

<h2> Changes in population size may have important effects on genetic variation and on the survival potential of viral species. Genetic bottlenecks are evolutionary events that reduce genetic variation of a population in a stochastic manner and result in founding populations that can lead to genetic drift.</h2>

Explanation:

<h2>Hopes this helps. Mark as brainlest plz!</h2>
8 0
3 years ago
Jared Harless shattered his elbow in a snowboarding accident and decided to visit a doctor at Smith Union Hospital for treatment
Sunny_sXe [5.5K]
<span>Well this isn't actually a question but to market to a company like this you first have to impress a small number of people in a single chain of command. Your products don't have to be marketed to a company as a whole or to a single rung of the food chain but to each successive member in a hierarchy in the company. Firstly to the employee, then to their management then to the ones who actually making the decision to buy.</span>
7 0
3 years ago
Which artery serves the distal part of the large intestine via its left colic, sigmoidal, and superior rectal branches?.
Elan Coil [88]
Inferior mesenteric artery
The part of the colon located distal to the left colic flexure is derived from the hindgut is supplied by the inferior mesenteric artery. The distal part (lower third of the rectum) is supplied by the internal iliac artery. The ileocolic artery supplying the cecum is a branch of the superior mesenteric artery.
8 0
2 years ago
here is a food chain in a meadow. Use this food chain to answer this question. Grass, Field Mouse, Corn Snake, Hawk Which is the
Aleks [24]
Plants are called producers because they make their own food. So the grass is the producer.
8 0
4 years ago
Read 2 more answers
Other questions:
  • Which of the following helps to safeguard biodiversity?
    11·2 answers
  • What is not a a form of passive transport
    5·1 answer
  • What is chlorophyll? Why is it green? I
    14·2 answers
  • The terms aerobic fitness and cardiorespiratory fitness mean the same thing<br> True or false?
    15·2 answers
  • What are two differences between a rhizoid and a rhizome?
    9·2 answers
  • Describe how waves behave when they interact with a barrier or boundary.
    13·1 answer
  • The _____ is the era of “recent life” on Earth.
    14·1 answer
  • An individual has type AB blood. His father has type A blood and his mother has type B blood. What is the individuals phenotype
    6·1 answer
  • Which of the following substances is neutral?
    12·1 answer
  • Which best describes global warming?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!