1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kogti [31]
3 years ago
11

4. Change any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid

Biology
1 answer:
ruslelena [56]3 years ago
7 0
Q1) 

the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.

<span>5’ agcggg  atg  agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here 
we change base A to T (capitalised)

DNA sequence with amino acids are given 
</span>5’ agcggg  atg  Tgc gca  tgt  ggc gca taa ctg 3’
N               Met Cys Ala Cys  Gly Ala stop 
after changing the base the amino acid sequence changes from Ser to Cys.

Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts 
</span>5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt  atg  cgc  cac  atg  cgc Aca tcc  cgc t 3'
              Met Arg  His Met  Arg  Thr Ser Arg
amino acid changes from Ser to Thr.

Q3) 
The sequence with amino acids before inserting a base is 
5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
We insert a base G shown in capitals 
5’ agcggg  atg  agc Ggca tgt  ggc gca taa ctg 3’

  This changes the codons of bases after the inserted base
5’ agcggg  atg  agc ggc atg  tgg  cgc ata act g 3’
                 Met  Ser Gly Met Trp Arg  Ile  Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
 to   Met  Ser Gly Met Trp Arg  Ile  Thr
                  
Q4)
the complementary strand before adding a base is 
5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
When we insert a base G, base C is added to the complementary strand 
5' cagtt  atg  cgc  cac  atg  cCgc tca tcc  cgc t 3'
this changes the codons
5' cagtt  atg  cgc  cac  atg  cCg ctc atc ccg ct 3'
              Met Arg His  Met  Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from 
Met Arg  His Met Arg  Ser Ser Arg 
to Met Arg His  Met  Pro Leu Ile Pro
You might be interested in
4. The pattern of inheritance in which more than one pair of genes affects a trait
alukav5142 [94]
Should be Polygenic inheritance... which is a type of incomplete dominance
3 0
3 years ago
Certain species of velvet worms have only female individuals and no males. These worms reproduce asexually. What is one advantag
Nady [450]
Okay bestayyy go off queen ahhh
8 0
3 years ago
The building blocks or monomers of nucleic acid molecules are called _____.?
SVEN [57.7K]
Nucleic acids are composed of nucleotides. These nucleotides are in themselves made by nucleosides (purines and pyrimidines) bound to one, two, or three phosphate groups. Thus, the answer is D.
5 0
4 years ago
A scientist measures the weight of two different animals one is 250 grams and the other is 330 grams in milligrams what is the d
ASHA 777 [7]
For the first animal: 250x1000=250000 mg

for the second animal: 330x1000=330000 mg

to find the difference: 330000-250000=80000 mg (which is your final answer)
6 0
4 years ago
On a hot summer day, Marcello purchases balloons for his mother’s birthday. He leaves the balloons in his car while he goes into
Angelina_Jolie [31]
The temp increased which caused the balloon to expand and burst
8 0
4 years ago
Read 2 more answers
Other questions:
  • Why can many ecosystems exist in one boime
    6·1 answer
  • When water freezes, it’s volume
    12·1 answer
  • Most of the lymph returns to the venous circulation by way of the
    15·1 answer
  • What organism is able to appear at any level in a food chain/web?why?
    10·1 answer
  • What is the purpose of the seed coat in plants??
    14·2 answers
  • What factor or factors are considered when a cell cultures environment is made as similar as possible to a cells natural surroun
    7·2 answers
  • What is the importance of gene flow to the biological species concept? What is the importance of gene flow to the biological spe
    14·1 answer
  • What is the difference between an anaerobic and an aerobic process?
    11·2 answers
  • SUNLIGHT
    14·2 answers
  • Each virus has a basic structure to it. Which of the following is NOT one of those basic structures?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!