1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gulaghasi [49]
3 years ago
14

Todd's girlfriend insisted he clean the cat litter box before he went to work at the restaurant. He was late and forgot to wash

his hands afterward. As soon as he entered the kitchen, the cook threw an apron at him and told him to start plating the food. Several customers came down with flu-like symptoms after their meal. Which parasite most likely infected them?
Biology
2 answers:
Marrrta [24]3 years ago
7 0

Answer:

<em>Toxoplasma gondii</em>

Explanation:

<em>Toxoplasma gondii </em>is a single celled parasitic organism. It is found in cat feces. It can cause toxoplasmosis by consumption of contaminated meat, coming in contact with infected cat feces or from mother to child during pregnancy. Most people do not develop symptoms but people with weak immune system and babies may develop flu like symptoms. The symptoms are headache, bodyache, swollen lymph nodes, fever and fatigue.

Since Todd had cleaned the cat litter box and forgot to wash his hands afterwards, he might have come in contact with the cat feces. The parasite was transferred from the feces to his hands from where it was transferred to the food which the customers ate and hence they call came down with flu like symptoms.

natulia [17]3 years ago
5 0
Toxoplasmosis is a bacteria in cat litter and can cause the flu.
You might be interested in
The process that moves bits of rock or soli from one place to another Mark only one oval
elena-14-01-66 [18.8K]

Answer:

erosion

Explanation:

hope this helps

:)))

3 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What is the name of the procedure for finding the volume of an irregular shaped solid called?
Evgen [1.6K]
Guass law ....i think
3 0
3 years ago
Read 2 more answers
Which best describes primary succession?
lora16 [44]

Answer:

Newly exposed or newly formed rock is colonized by living things for the first time.

Explanation:

In other world rock is being inhabited. A community is beginning to form.

8 0
3 years ago
12. Solar energy enters food chains through the life processes of
photoshop1234 [79]

Answer:

(4) Producers

Explanation:

3 0
3 years ago
Other questions:
  • In a brain surgery that went wrong, matthew lost a portion of his _____ cortex and has blindness in part of his field of vision.
    8·1 answer
  • The disease erythroblastosis fetalis develops in a fetus or a newborn infant with Rh-positive blood and an Rh-negative mother. S
    6·1 answer
  • What do all cell types have in common? Choose more than one answer.
    6·2 answers
  • Question #1:
    12·1 answer
  • Make a quick list of the foods that you eat during your last meal... hypothesize what would happen to the supply of those foods
    13·1 answer
  • What might happen to the human heart during a trip to Mars?
    8·2 answers
  • A gardener wanted to know if E-Z fertiliser would be good for his vegetables. He fertilised all his bean plants with E-Z fertili
    11·1 answer
  • For hundreds of years one species of moth has always gone back to the same type of tree in the forest to breed. A small portion
    6·1 answer
  • Fill in: Name the organelle or organelles that perform each of the following functions. A. _____________________ convert sunligh
    6·2 answers
  • How can biodiversity be protected at global level, species level and genetic level​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!