1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katovenus [111]
3 years ago
12

The gas in the atmosphere that, when combined with water, makes an acid which attacks rocks is

Biology
2 answers:
Pavel [41]3 years ago
7 0
Is chemical weather or acid rain which ever one u choose
Zigmanuir [339]3 years ago
5 0
Sulfur dioxide in the atmosphere.
You might be interested in
What are the 2 main ideas behind natural selection? (will give brainlist!)
ioda

1-Charles Darwin

2-Alfred Russel Wallace

Explanation:

are jointly credited with coming up with the theory of evolution by natural selection, having co-published on it in 1858. Darwin has generally overshadowed Wallace since the publication of On the Origin of Species in 1859, however.

7 0
3 years ago
Which statement is true of both mitosis and meiosis?
timofeeve [1]

Answer:

The statement 'b. both occur only in reproductive cells' is true

5 0
2 years ago
Is pawpaw a local food crop
Volgvan

Answer:

Pawpaw means papaya. Hope you'll get some clues from here

4 0
2 years ago
What is an example of malignant tumor?
sergey [27]

Answer:

Carcinoma.

Explanation:

These tumors form from epithelial cells, which are present in the skin and the tissue that covers or lines the body's organs. Carcinomas can occur in the stomach, prostate, pancreas, lung, liver, colon, or breast.

3 0
2 years ago
Building blokes of proteins are _____
gulaghasi [49]
The building blocks of protein are C. AMINO ACIDS.

Amino acids are made up of a center carbon atom bound positively to a charged amino group and a negatively charged carboxyl group and a side chain.

The primary structure of a protein is the sequence of an amino acids that are attached together by a peptide bond

The secondary structure of a protein,  the polypeptide is folded through the  mechanisms of amino acids rotating around bonds folding into a helix or a pleated sheet structure and stabilized by a hydrogen bond.
6 0
3 years ago
Other questions:
  • About how much protein should a 24-pound (i.e., 11.0kg), 2-year-old be consuming each day?
    15·2 answers
  • Which of these is an environmental change that occurs rapidly?
    13·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is the function of NADH?
    5·1 answer
  • An ice cube melts in a room, this is an example of what type of energy??
    12·2 answers
  • Carbon atoms are able to: give off electrons to form negative carbon ions bond with other carbon atoms to form long chains gain
    13·2 answers
  • An individual who inherits the gene for blood type A from one parent and blood type O from the other parent will have what blood
    15·1 answer
  • Any tree can breed with any other tree, so they are all of the same species. True or false?
    13·2 answers
  • What is the meaning of cycle​
    7·1 answer
  • Which statement describes what happens to the carbon dioxide produced in cellular respiration?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!