1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xenn [34]
3 years ago
13

"Jacob has just gotten an interview for a job he really wants. With his excitement, his heartbeat increases, his blood pressure

rises, and he begins to perspire. Which nervous system is responsible for these physiological changes?"
Biology
1 answer:
Levart [38]3 years ago
4 0

Answer: Sympathetic nervous system

Explanation:

<u>The sympathetic nervous system (SNS) along with the parasympathetic nervous system (PSNS) are part of the autonomic nervous system (ANS). </u>

<u>The autonomic nervous system acts unconsciously and it controls involuntary functions</u> such as the heart rate, respiratory rate or digestion and to do this it operates through a series of interconnected neurons.

The sympathetic nervous system activates what is known as the "fight or flight" response. For example, it can accelerate heart rate, decrease motility of the large intestine, constrict blood vessels, cause pupillary dilation, and raise blood pressure. This means it prepares the body for intense physical activity.

On the other hand, parasympathetic is referred to as "rest and digest" and it is antagonistic to the parasympathetic nervous system because it produces a calm and relaxed feeling in the mind and body. For example, the PSNS works to slow the heart rate down and lower blood pressure.

The changes experienced by Jacobo are due to the sympathetic nervous system due to the emotion he feels before the job interview, which stimulates him to act and feel ready to carry out the action of going to that interview.

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Can you guys please help me I’m struggling
Anit [1.1K]

Answer:

look at the photo that I attatched

8 0
3 years ago
Read 2 more answers
Can someone give me a 10th or 11th grade science fair topic?? i have no clue what to do!!!!​
krok68 [10]

Answer:

Environmental issues, green chemistry, genetics, classification, cells, and energy. Choose anyone

4 0
3 years ago
Read 2 more answers
The graphic shows the citric acid cycle. A diagram of the citric acid cycle is shown. Acetyl C o A enters the citric acid cycle
vagabundo [1.1K]

Answer:

It enters the citric acid cycle and associates with a 4-carbon molecule, forming citric acid, and then through redox reactions regenerates the 4-carbon molecule.

Explanation:

Acetyl-CoA(2C) associates with oxalacetate(4C) to form citric acid(6C). Then through redox reactions, CO2 molecules result from decarboxylation (COOH becomes R-(R1)CH-R2). And through dehydrogenation H2 molecules are incorporated in NADH+ in FADH2, resulting in the 4-carbon molecule at the beginning (oxalacetate). That's why it's called a cycle(Kreb's cycle or citric acid cycle)

3 0
3 years ago
Read 2 more answers
In messenger RNA, each codon calls for a
olganol [36]

Answer: c) amino acid

Explanation: A codon is an mRNA sequence which contains three nucleotides that codes for a particular amino acid. The codons on the mRNA are read by the ribosome during translation and the amino acid coded for by each codon is used to make a protein. There are 64 different codons in existence, each amino acid is coded for by at least one codon. Some amino acids have more than one codon. For example, the amino acid Leucine is coded for by six codons: UUA, UUG, CUU, CUC, CUA and CUG while the amino acid phenylalanine is coded for by two codons: UUU and UUC.

5 0
3 years ago
Other questions:
  • What is the difference between a dental hygienist and a dental assistant?
    8·2 answers
  • How many different possible codon combinations are possible using the three letter alphabet of DNA
    10·1 answer
  • All of the following are examples of organic matter soil except
    9·1 answer
  • Water vapor in the atmosphere is important for which of the following reasons?
    10·1 answer
  • How would Darwin’s explanation of long necks in giraffes differ from Jean Baptiste Lamarck’s explanation of the same trait?
    5·1 answer
  • Which of the following describes an event that results from mitosis?
    5·1 answer
  • Viruses have many things in common with living organisms, but they are NOT actually considered living. Why?
    7·1 answer
  • somebody help me with this science assignment, if you help Ill mark you brainliest and ill give you a thanks
    12·1 answer
  • Describe the advantage of broad-leaved trees losing their leaves as winter sets in and the advantage of needle-leaved trees keep
    10·1 answer
  • 1. What characteristics of an atom give it unique properties?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!