1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
3 years ago
5

What is used to collect a dna sample from greg answer?

Biology
1 answer:
Whitepunk [10]3 years ago
5 0
I believe the Buccal swaps are used to collect DNA samples from Greg in the Cheeks. 
Buccal swaps are also called buccal smears, they are ways used to collect DNA from the cells on the inside of a person's cheek. They are a relatively non-invasive way to collect DNA samples for testing. 
You might be interested in
The nucleus of "Lead-208", 208 82 Pb, has 82 protons within a sphere of radius 6.34×10-15 m. Each electric charge has a value of
jarptica [38.1K]

Answer:

2.94 × 10²⁰ N/C

Explanation:

Given that:  

The nucleus of "Lead-208 has 82 protons,

with a radius (r) 6.34×10-15 m, &

each electric charge has a value of 1.60218 × 10^-19 C

∴ The formula for calculating an electrical field at the surface of the nucleus is:

 E=\frac{k*q}{r^2}  

Substituting our values into the equation above, we have;

 E = \frac{8.98755*10^8*82(1.60218*10^{-19C)}}{(6.34*10^{-15}_m)^2}

E = 2.93870499×10²⁰ N/C

E ≅ 2.94 × 10²⁰ N/C

6 0
3 years ago
Which legs for a frog are used for jumping?
mario62 [17]
The hind legs, I believe. That's why they are longer and stronger.
7 0
3 years ago
Which property of water causes ice wedging?
kicyunya [14]

Answer:

C

Explanation:

edge 2022

7 0
2 years ago
A patient mangled his left hand in machinery requiring amputation at the wrist. the wound has healed and the patient is fitted w
SSSSS [86.1K]

The correct answer is 97761 * 2, L6050, Z44.8, Z89.11.  

In the CPT index when one looks for Prosthetics/Training, then one is directed towards 97761. The code is repeated for every 15 minutes. As 30 minutes are spent in training, so 2 units are reported. In the HCPCS level II codebook when one looks for Disarticulation/Wrist prosthesis, one is directed towards codes L6050, L6055. On the basis of description, the prosthesis is reported with code L6050.  

In the alphabetic index of ICD-10-CM, when one looks for fitting/device NOS/prosthetic (external), then one is directed towards the code Z44.8. In the index when one looks for the absence of organ or part (complete or partial)/wrist and hand (acquired) then one is referred towards the code Z89.11.  


6 0
3 years ago
What evidence shows that white dwarfs must be very small?
Drupady [299]

Spectral analysis proposes that there is no hydrogen fusion roughly speaking. They are hot since they are very thick. So if you are a convinced high density and temperature and still not doing synthesis, you must be small. Also, stellar evolution models are founded on the observation of planetary nebulae, where stars have shed most of their mass after being red giants. The physics designates a small, hot, central remainder. 

7 0
3 years ago
Other questions:
  • During the rainy season, and just as the dry season starts, food is abundant for all finches. However, as the dry season wears o
    5·1 answer
  • What does your body need to take in to break down lactic acid?
    15·1 answer
  • What is one disadvantage and one advantage of asexual reproduction compared with sexual reproduction?
    13·1 answer
  • Which list correctly aligns the levels of organisms from the least to the most complex?
    11·2 answers
  • A skin cell should generate an exact copy of itself. Through which process would this occur?
    12·2 answers
  • Which of these results is an advantage of the green transportation technology shown in the picture compared with gasoline techno
    10·2 answers
  • Help anyone please lol be serious
    10·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What is the difference between the axial and appendicular skeleton?
    5·1 answer
  • A science fiction movie shows a spaceship traveling past Pluto, Saturn, the Moon, and the Andromeda galaxy. Which of these celes
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!