1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wlad13 [49]
3 years ago
13

What is 15ml to the nearest 0.1 ml

Biology
2 answers:
Advocard [28]3 years ago
8 0
The answer is 20Ml
KATRIN_1 [288]3 years ago
3 0
The answer is 20ml. You have 15 and round it up because if your number in the ones digit is 5 or higher you round up. In this case you would round 15ml up to 20ml.
You might be interested in
Arboreal animals are animals that _______. a. rely on trees for food b. live in trees c. are harmful to trees d. none of the abo
sveticcg [70]

Answer:

The correct answer is B) lives in trees

Explanation:

Hope this helps  :)

4 0
2 years ago
Can you tell the difference between the original and the replicated strand
kati45 [8]

Answer:

Original strand is the old strand and replicated strand is new strand.

Explanation:

DNA is replicated by the semi-conservative way which means the new strand is replicated over the old strand and one DNA duplex has one new strand and one old strand. So the original strand is the old strand and the replicated strand is the strand that is synthesized over the original strand.

In DNA the replicated strand is made by adding nucleotides complementary to the opposite nucleotide present in the template or original strand. Adenine and thymine make complementary base pairing with each other and guanine and cytosine makes complementary base pairing with each other.

6 0
3 years ago
choose the best answer. what is the function of leaf? A. Photosynthesis. B. Transpiration. C. Aeration. D. None
NARA [144]

The function of leaf is A. photosynthesis

6 0
3 years ago
Read 2 more answers
What are two different events that occur during metaphase?​
e-lub [12.9K]

Answer:

The next two major events that take place in mitosis are the alignment of chromosomes at the center of the cell and the subsequent separation of sister chromatids to opposite mitotic spindle poles. These two events occur in metaphase and anaphase, respectively.

Explanation:

7 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Other questions:
  • Aquaporins are channel proteins that facilitate the transport of water across the cell membrane. One group of researchers hypoth
    9·1 answer
  • 36. In the Calvin cycle, where plants use the energy from photosynthesis to synthesize glucose, what enzyme is need for carbon f
    5·1 answer
  • The offspring of a particular cross are 100 percent heterozygous for tallness. What were the most likely genotypes of the parent
    14·1 answer
  • Why Thawed food should never be Refrozen ?​
    13·2 answers
  • BRAINLIESTTT ASAP!!
    12·1 answer
  • I WILL GIVE BRAINLIEST!!
    8·1 answer
  • Why is still water an ideal environment for the formation of mold and cast fossils?
    14·1 answer
  • What is gylcosylation
    8·2 answers
  • Cavendish bananas are popular species among banana growers because they're predictable. All of these bananas are grown to have t
    12·2 answers
  • What are the three reactants taken in during photosynthesis?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!