1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gekata [30.6K]
3 years ago
12

Name  Producers in the Amazon River.

Biology
1 answer:
alexdok [17]3 years ago
6 0
Some producers are Water Ivy, some "river grass" and many more organisms.
You might be interested in
Which phrase best describes the main function of the stomach?
Roman55 [17]
A.
contracts to move substances through the body
D.
breaks down food to acquire nutrients
3 0
3 years ago
What two species are most closely related from the evolutionary tree
Vedmedyk [2.9K]

Answer:

Species a and c

Explanation:

The species c, was more closely related to species a than species b was. This is because species a and c just recently evolved into different species in evolutionary history.

4 0
2 years ago
Site 3: http://www.experiment-resources.com/darwins-finches.html
Taya2010 [7]

Answer:

Have a good day!

Explanation:

5 0
2 years ago
Which event contributed to life evolving on Earth <br>​
Helen [10]

Answer:natural selection

Explanation:

3 0
3 years ago
Compare and contrast the reasons cell division is important for unicellular and multicellular organisms. 2. Provide an example o
Ganezh [65]

(1)

For unicellular organisms, cell division is important for the reproduction of the population, Unicellular organism mainly use cell division, also called binary fission, for pollution growth. This is because unicellular organisms are only composed of one cell.

Multicellular organisms use cell division for growth and reproduction. Cell division causes increase in the number of cells composing the organism hence its growth in size. Cell division is also used to create gametes that are used in reproduction by fertilization.

(2)

Even in fully developed organisms, cell division is important in tissue repair. In tissue homeostasis, there is a balanced rate of cell division and cell death .  An example in muscles. Due to the stress experienced by muscle cells, they usually have a lower life span and therefore the damaged cells are often replaced with new ones by cell division. This prevents tissue wastage.

(3)

Growth factors signal the growth of a cell. They usually bind receptors on the cell surface and indicate how the cell should grow and divide base don environmental stimuli. An example is during regular exercises. Growth factors indicate that the muscle cells should divide regularly and grow bigger to accommodate the higher stress in the muscles from the workout. This is how your muscles grow bigger and stronger with more exercise.  

(4)

Differentiation of cells occurs through the silencing of some gene allowing the cell to produce particular proteins (and other biomolecules) that align with its functions in the body. This especially critical in multicellular organisms.  An example is that while al the cells in your body have the same DNA, some cells differentiate into liver cells while others into lungs, stomach, heart, and etcetera.  

Learn More:

For more on cell division check out;

brainly.com/question/4365207

brainly.com/question/11266913

#LearnWithBrainly

6 0
3 years ago
Other questions:
  • A nurse fails to communicate a change in the client's condition to the physician. which element related to proving malpractice h
    13·1 answer
  • Which branch point represents the most recent common ancestor of all bears?
    7·1 answer
  • Why does cell division remain important to an adult organism even after it's fully developed
    9·1 answer
  • Fill in the with what each type of organic compound is made up of.
    13·2 answers
  • Sean outperforms the other air traffic controllers, accurately detecting three times as many potential airplane space violations
    10·1 answer
  • A method that uses a mathematical equation and the half-life of decay to determine the exact date of a fossil is known as
    8·1 answer
  • How long would it take Kevin to complete all his task?​
    9·1 answer
  • Why was it important to allow all the investigation materials to assume room temperature before beginning the experiment?
    12·1 answer
  • A _______________________ recognizes and destroys cells infected by a virus.
    10·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!