1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NemiM [27]
4 years ago
8

Smooth muscle is also called

Biology
1 answer:
Eva8 [605]4 years ago
8 0
Smooth muscle is involuntary muscle tissue
You might be interested in
Why is study of wheat genome is difficult task?
Phantasy [73]

Answer:

Due to large size of genome.

Explanation:

The study of wheat genome is difficult task because of its large size. The genome of wheat comprise of 15 billion DNA bases. The wheat genome is three times bigger in size as compared to the genome of mammoth. Mammoth is an extincted specie of elephant which were the biggest land animal at that time. So due to large genome size of wheat, the scientists takes more time to complete its sequencing (order of nucleotide in the DNA).

3 0
3 years ago
Is baking a cake a chemical or physical change?
aleksandrvk [35]
It is chemical because of the heat and gas which causes air bubbles
8 0
3 years ago
Read 2 more answers
Plant roots help hold soil together. how can shrub and tree branches also help hold soil together?
Mama L [17]
Root systems in the soil branch out in the soil forming a mesh-like framework that prevents soil erosion by enhancing soil stability. Fine roots may improve soil permeability to water. This can be illustrated when, for instance, you pull a small plant out of the soil, some soil will cling to the roots.
5 0
4 years ago
WILL MARK BRAINLIEST!! 20 POINTS! thank you
VARVARA [1.3K]

Answer:

1.  Flower ( Pollination )

2. Leaf ( For photosynthesis to occur )

3. Stem ( Holds the flower/structure )

4. Roots ( To provide nutrients and stability )

Hope this help :)

Have a great day

5INGH

Explanation:

6 0
3 years ago
Read 2 more answers
Oxygen-16 has 8 protons. How many neutrons does it have?
LuckyWell [14K]
It has Eight Neutrons as well
:P
7 0
4 years ago
Other questions:
  • List one way predator/prey relationships are different from parasitic relationships
    14·1 answer
  • Which of the following is a biological catalyst?
    9·2 answers
  • If something is volatile, it _____ easily.
    12·1 answer
  • One modern idea on the origin of life states that simple organic molecules such as water vapor, carbon dioxide, nitrogen, methan
    13·1 answer
  • Nucleric acids in eukaryotes, DNA is found chiose all apply
    5·2 answers
  • 12. An example of a hydrogen bond is the bond between?
    12·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • At which age range does the most intensive myelination of nerve cells occur?
    8·1 answer
  • Pls help me??????????
    6·1 answer
  • What is the role of a condenser in the microscope
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!