Athletes and physically active people have increased needs for

1 answer:

3 0

They have increased need to carbohydrates, protein, water and iron.

Carbohydrates is the primary source for energy and active people apparently need more energy for their daily activities.

Protein helps build muscles, even though they only need a small amount more of protein than normal people, they still require protein for muscle buildings.

Water has to be needed as they may excrete more sweat by active activities in the day time. Water can also help remove waster material from body.

Iron helps the production of hemoglobin, which is in the red blood cells that help transport oxygen. As they exercise more, they need more oxygen supply for respiration, therefore there is a need for iron supply.

You might be interested in

Using the photosynthesis equation, predict how the rate of photosynthesis might change with variation in the following parameter

snow_lady [41]

Answer AND Explanation:

Light provides the energy required to drive the process of photosynthesis. The rate of photosynthesis increases as light intensities increase. At high light intensities, much of the light is penetrates through the leaf and is absorbed by the chloroplasts.

3 0

3 years ago

What types of bedrock fossils are found in sedimentary rocks?

BARSIC [14]

Answer:

shale, limestone and sandstone.

Explanation:

4 0

3 years ago

Read 2 more answers

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

liubo4ka [24]

The mRNA generated below was produced in the nucleus of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.