1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldenfox [79]
3 years ago
10

Describe how the nucleus, endoplasmic reticulum, ribosomes, Golgi apparatus, and vesicles work to produce protein?

Biology
1 answer:
Alinara [238K]3 years ago
5 0

The endoplasmic reticulum takes the proteins that are made by the ribosomes and folds them into sacs that are called cisternae. It then transports these folded proteins to the Golgi apparatus. ... They are then released from the Golgi apparatus in what are called secretory vesicles into the cytoplasm.

You might be interested in
The accumulation of O2 in the atmosphere is due to the:
FromTheMoon [43]

c. Light independent reactions

5 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Summary for mutations
Talja [164]

Answer:

A mistaken change in DNA sequencing or coding that could be harmful, not noticed or beneficial

Hope this helps!

4 0
3 years ago
2+2=???? idkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidk
Tasya [4]

Answer:

4

Explanation:

2+2=4. It is a very complex equation. Hope this helps!

-Aslina

7 0
3 years ago
What nucleotide is used during transcription instead of thymine
enyata [817]
It differs from DNA chemically in two respects: (1) the nucleotides in RNAare ribonucleotides—that is, they contain the sugar ribose (hence the name ribonucleic acid) rather than deoxyribose; (2) although, like DNA,RNA contains the bases adenine (A), guanine (G), and cytosine (C), it contains the base uracil (U) .
3 0
3 years ago
Other questions:
  • Voluntary or conscious activities of the body are controlled by the a. medulla oblongata. b. cerebrum. c. cerebellum. d. brain s
    15·1 answer
  • What would happen if another substance competed for the enzyme active site?
    15·1 answer
  • What is the end result of eukaryotic cell cycle?
    14·2 answers
  • If a certain blood cell has a diameter of 0.008 millimeter, and a certain muscle cell has a diameter of 0.07 millimeter, then th
    15·1 answer
  • Please help i need an answer asap :(
    8·1 answer
  • Arrange the steps of the chemical response of a cell to epinephrine in the correct order. 1. production of GTP from GDP 2. conve
    6·1 answer
  • A specific type of bacteria reproduces through binary fission every two hours. If there are seven bacteria to begin with, how ma
    13·2 answers
  • The urban migration trend has stopped worldwide.
    6·2 answers
  • A plant of genotype ccdd is crossed to ccdd and the f1 is testcrossed to ccdd. if the genes are unlinked, what percentage of ccd
    6·1 answer
  • When randomly selecting an​ adult, a denotes the event of selecting someone with blue eyes. What do and ​represent?.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!